Ancylis burgessiana

(Zeller, 1875) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Ancylis

At a glance

Occurrence records1 173

Data sources7

Biological traits0

DNA specimens110

eDNA detections28

Sources7 archives

Databases and archives Ancylis burgessiana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 173 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics110 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 173 records

Environmental DNA1 datasets · 2 countries28 detections

DNA & barcodingBOLD110 specimens

01Narrative

Ancylis burgessiana is een vlinder uit de familie van de bladrollers (Tortricidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1875 door Zeller.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding110 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylis burgessiana has left across the world's sequence archives.

At a glance

DNA specimens110

BINs2

Marker genes1

eDNA detections28

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus107 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

40Avariable

49Cmostly conserved

59Cmostly conserved

74Cmostly conserved

88Avariable

92Tmostly conserved

97Tmostly conserved

100Tmostly conserved

103Tmostly conserved

127Tmostly conserved

160Amostly conserved

163Amostly conserved

181Tmostly conserved

197Tmostly conserved

235Tmostly conserved

271Cmostly conserved

274Cmostly conserved

292Tmostly conserved

312Amostly conserved

313Cmostly conserved

316Amostly conserved

364Amostly conserved

379Tmostly conserved

412Amostly conserved

418Cvariable

436Cmostly conserved

463Tmostly conserved

514Tmostly conserved

517Tmostly conserved

520Amostly conserved

548Cmostly conserved

562Avariable

604Cmostly conserved

643Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCCTTAAGATTACTAATTCGAGCTGAACTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 48 variants.

Diversity (π)1.8%

Haplotypes48

BINs2

Most divergent pair4.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylis platananasame genus4.7%Ancylis simuloidessame genus4.7%Ancylis columbianasame genus4.9%Ancylis maritimasame genus5.0%Ancylis nubeculanasame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 173 records

Wild obs. + sensor955

Museum / vouchered218

Range

Area of Occupancy AOO2 544 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 528≤1 km 170≤10 km 40>10 km 47

785 georeferenced · 170 without coordinates

Open the mapobservation + sensor955

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 2≤1 km 48≤10 km 39>10 km 14

103 georeferenced · 115 without coordinates

Open the institutions mapphysical evidence218

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	63
Mississippi State, US	56
St. Paul, US	27
Philadelphia, US	16
University of Alberta Museums (UAM)location not on record	14
New Haven, US	10
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
Research Collection of Daniel Handfieldlocation not on record	6
Cambridge, US	3
Royal Saskatchewan Museumlocation not on record	2
Colorado State Universitylocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

12 institutions · 207 of 218 vouchered records shown · 11 without an institution code

09Environmental DNA28 detections

Where the DNA of Ancylis burgessiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map2 countries0

Temperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 3.70–19.7

Seasonal swing summer↔winter28.8 °C

Max temp (day)21.0 °C 8.80–24.5

Min temp (night)11.7 °C -0.8–15.1

Precipitation112 mm/mo 83.3–140

Air humidity58.9 % 55.6–61.7

Moisture balance-4.60 mm/mo -52.2–51.8

Vapour deficit744 Pa 357–966

Wind speed2.80 m/s 2.40–3.70

Cloud cover44.5 % 38.8–49.6

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ancylis burgessiana

At a glance

Sources7 archives

At a glance

Record type1 173 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 173 records