Ancylis platanana

(Clemens, 1860) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Ancylis

At a glance

Occurrence records534

Data sources8

Biological traits0

DNA specimens20

eDNA detections23

Sources8 archives

Databases and archives Ancylis platanana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility534 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF534 records

Environmental DNA1 datasets · 1 countries23 detections

DNA & barcodingBOLD20 specimens

01Narrative

Ancylis platanana, size: 5.8 mm Ancylis platanana, size: 5.8 mm Ancylis platanana is a species of moth of the family Tortricidae. It is found in the eastern United States, including Illinois, Maryland, North Carolina, Oklahoma, PennsylvaniaBug Guide and Texas. The wingspan is 11–15 mm. It is a variable species. There are at least four generations per year. The larvae feed on Platanus species, including Platanus occidentalis. They live on the underside of the leaves, folding them slightly and spinning a web shelter under which they feed and pupate.Parasitoids Reared from Ancylis platanana (Clemens) (Lepidoptera: Tortricidae)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylis platanana has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

eDNA detections23

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

313Cmostly conserved

616Cmostly conserved

625Avariable

AACACTATATTTTATTTTTGGGATTTGAGCTGGAATAGTAGGAACTTCCCTAAGATTATTAATTCGAGCTGAACTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.19%

Haplotypes6

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylis lacinianasame genus4.6%Ancylis discigeranasame genus4.7%Ancylis burgessianasame genus4.7%Ancylis fuscocilianasame genus4.9%Ancylis mirasame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type534 records

Wild obs. + sensor443

Museum / vouchered91

Range

Area of Occupancy AOO1 232 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 176≤1 km 98≤10 km 17>10 km 42

333 georeferenced · 110 without coordinates

Open the mapobservation + sensor443

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 6≤1 km 2≤10 km 25>10 km 7

40 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence91

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	45
St. Paul, US	18
Philadelphia, US	11
King Saud Universitylocation not on record	4
East Lansing, US	4
Cambridge, US	1
CUlocation not on record	1
New Haven, US	1

8 institutions · 85 of 91 vouchered records shown · 6 without an institution code

09Environmental DNA23 detections

Where the DNA of Ancylis platanana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 12.7–25.1

Seasonal swing summer↔winter23.4 °C

Max temp (day)22.8 °C 18.0–29.9

Min temp (night)12.5 °C 8.80–22.7

Precipitation126 mm/mo 102–139

Air humidity58.2 % 55.2–60.2

Moisture balance-23.4 mm/mo -58.6–2.00

Vapour deficit846 Pa 650–1,331

Wind speed3.70 m/s 2.30–4.90

Cloud cover38.8 % 31.0–41.0

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)