Ancylis laciniana

(Zeller, 1875) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Ancylis

At a glance

Occurrence records277

Data sources7

Biological traits0

DNA specimens14

eDNA detections6

Sources7 archives

Databases and archives Ancylis laciniana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility277 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF277 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD14 specimens

01Narrative

Ancylis laciniana is een vlinder uit de familie van de bladrollers (Tortricidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1875 door Zeller.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylis laciniana has left across the world's sequence archives.

At a glance

DNA specimens14

BINs2

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 45 variable positions, in barcode order

22Amostly conserved

40Avariable

49Cmostly conserved

50Tmostly conserved

59Cmostly conserved

74Cmostly conserved

82Tmostly conserved

88Avariable

91Amostly conserved

100Tmostly conserved

139Tmostly conserved

163Amostly conserved

169Tmostly conserved

181Tmostly conserved

202Tmostly conserved

263Tmostly conserved

271Cvariable

313Cvariable

355Cmostly conserved

364Amostly conserved

379Tmostly conserved

382Tmostly conserved

400Amostly conserved

412Avariable

418Cmostly conserved

433Amostly conserved

436Cmostly conserved

469Amostly conserved

493Amostly conserved

514Tmostly conserved

520Amostly conserved

548Cmostly conserved

556Amostly conserved

562Gvariable

565Amostly conserved

568Tmostly conserved

578Tmostly conserved

580Amostly conserved

586Tmostly conserved

604Cmostly conserved

607Tmostly conserved

631Tmostly conserved

643Tmostly conserved

646Tmostly conserved

652Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCCTTAAGATTACTAATTCGAGCTGAACTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes9

BINs2

Most divergent pair5.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylis platananasame genus4.6%Ancylis simuloidessame genus4.9%Ancylis columbianasame genus5.0%Ancylis maritimasame genus5.2%Ancylis nubeculanasame genus5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type277 records

Wild obs. + sensor212

Museum / vouchered65

Range

Area of Occupancy AOO624 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 109≤1 km 36≤10 km 8>10 km 16

169 georeferenced · 43 without coordinates

Open the mapobservation + sensor212

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤1 km 3≤10 km 5>10 km 3

11 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence65

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	29
Mississippi State, US	15
Research Collection of Daniel Handfieldlocation not on record	6
Philadelphia, US	5
University of Alberta Museums (UAM)location not on record	5
New Haven, US	2
Georgia Museum of Natural Historylocation not on record	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	1

8 institutions · 65 of 65 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Ancylis laciniana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 15.4–17.7

Seasonal swing summer↔winter31.1 °C

Max temp (day)22.7 °C 20.4–22.7

Min temp (night)13.0 °C 10.4–13.0

Precipitation85.2 mm/mo 85.2–101

Air humidity58.5 % 57.8–58.5

Moisture balance-50.2 mm/mo -50.2–-22.2

Vapour deficit839 Pa 745–839

Wind speed2.50 m/s

Cloud cover43.3 % 43.3–45.2

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)