Ancylis albacostana

Kearfott, 1905 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Ancylis

At a glance

Occurrence records147

Data sources7

Biological traits0

DNA specimens8

eDNA detections9

Sources7 archives

Databases and archives Ancylis albacostana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility147 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF147 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD8 specimens

01Narrative

Ancylis albacostana is een vlinder uit de familie van de bladrollers (Tortricidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1905 door William Dunham Kearfott

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylis albacostana has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes1

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 61 variable positions, in barcode order

19Tmostly conserved

22Amostly conserved

31Tmostly conserved

38Amostly conserved

40Tmostly conserved

59Tvariable

100Amostly conserved

133Tmostly conserved

157Cmostly conserved

193Cmostly conserved

205Amostly conserved

217Tmostly conserved

220Amostly conserved

235Tmostly conserved

238Amostly conserved

247Cmostly conserved

274Tmostly conserved

278Amostly conserved

286Amostly conserved

287Cmostly conserved

298Amostly conserved

307Amostly conserved

340Tmostly conserved

349Tmostly conserved

355Cmostly conserved

367Cmostly conserved

379Tmostly conserved

386Tmostly conserved

388Amostly conserved

397Tmostly conserved

400Cmostly conserved

401Cmostly conserved

403Tmostly conserved

412Amostly conserved

421Tmostly conserved

424Tmostly conserved

433Amostly conserved

472Cmostly conserved

478Tvariable

499Amostly conserved

508Tvariable

514Avariable

520Tmostly conserved

536Tmostly conserved

538Amostly conserved

556Amostly conserved

562Amostly conserved

571Cmostly conserved

574Tmostly conserved

578Cmostly conserved

580Tmostly conserved

581Tmostly conserved

583Amostly conserved

589Cmostly conserved

596Tmostly conserved

598Amostly conserved

601Tvariable

619Cmostly conserved

622Tmostly conserved

628Amostly conserved

631Avariable

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.0%

Haplotypes5

BINs2

Most divergent pair8.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylis simuloidessame genus5.8%Ancylis columbianasame genus5.8%Ancylis nubeculanasame genus5.9%Ancylis metamelanasame genus6.1%Ancylis apicellasame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type147 records

Wild obs. + sensor122

Museum / vouchered25

Range

Area of Occupancy AOO272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 77≤1 km 8≤10 km 4>10 km 2

91 georeferenced · 31 without coordinates

Open the mapobservation + sensor122

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 12≤1 km 4≤10 km 3>10 km 1

20 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	11
East Lansing, US	5
St. Paul, US	4
New Haven, US	3
San Francisco, US	1
Saint John, CA	1

6 institutions · 25 of 25 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Ancylis albacostana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.9 °C 18.3–19.9

Seasonal swing summer↔winter31.6 °C

Max temp (day)23.8 °C 23.4–25.6

Min temp (night)13.9 °C 13.5–15.4

Precipitation102 mm/mo 82.4–107

Air humidity57.4 % 55.8–58.5

Moisture balance-44.2 mm/mo -66.3–-26.2

Vapour deficit961 Pa 866–987

Wind speed3.30 m/s 2.80–3.50

Cloud cover46.1 % 38.4–48.5

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)