Ancistrocerus unifasciatus

(de Saussure, 1853) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Vespidae/Ancistrocerus

At a glance

Occurrence records935

Data sources6

Biological traits0

DNA specimens6

eDNA detections4

Sources6 archives

Databases and archives Ancistrocerus unifasciatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility935 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF935 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD6 specimens

01Narrative

Ancistrocerus unifasciatus (лат.) — вид одиночных ос из семейства Vespidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancistrocerus unifasciatus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Diversity (π)3.5%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 57 variable positions, in barcode order

31Tmostly conserved

40Cmostly conserved

41Gmostly conserved

43Tmostly conserved

44Tmostly conserved

46Amostly conserved

47Gmostly conserved

50Cmostly conserved

52Amostly conserved

58Amostly conserved

59Amostly conserved

61Tmostly conserved

68Tmostly conserved

69Tmostly conserved

70Amostly conserved

80Amostly conserved

81Cmostly conserved

82Cmostly conserved

87Amostly conserved

88Tmostly conserved

89Amostly conserved

90Amostly conserved

91Amostly conserved

92Tmostly conserved

94Amostly conserved

98Amostly conserved

99Amostly conserved

101Amostly conserved

118Cmostly conserved

119Amostly conserved

120Cmostly conserved

122Amostly conserved

124Tmostly conserved

127Tmostly conserved

131Tmostly conserved

139Cmostly conserved

143Amostly conserved

145Tmostly conserved

170Tmostly conserved

200Amostly conserved

202Tmostly conserved

205Tmostly conserved

206Tmostly conserved

208Amostly conserved

212Amostly conserved

214Cmostly conserved

215Amostly conserved

216Cmostly conserved

217Tmostly conserved

220Tmostly conserved

223Tmostly conserved

226Cmostly conserved

232Tmostly conserved

235Cmostly conserved

238Amostly conserved

262Amostly conserved

268Gmostly conserved

ATTATTATATTTTATCTTTGGACTTTGATCTGGAATAATCGGTTCAGCCCTAAGAATAATTATTCGATTAGAATTAGGTACCCCAGATAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancistrocerus campestrissame genus12.8%Ancistrocerus adiabatussame genus12.9%Ancistrocerus lineativentrissame genus13.1%Ancistrocerus albolacteussame genus13.1%Ancistrocerus nigricornissame genus13.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type935 records

Wild obs. + sensor887

Museum / vouchered48

Range

Area of Occupancy AOO2 700 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 508≤1 km 144≤10 km 46>10 km 75

773 georeferenced · 114 without coordinates

Open the mapobservation + sensor887

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤1 km 1≤10 km 15

16 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence48

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	20
Champaign, US	15
US	3
Saint John, CA	2
University Park, US	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Provincia di Livornolocation not on record	1
OSUClocation not on record	1
Toronto, CA	1
Royal Ontario Museumlocation not on record	1

10 institutions · 47 of 48 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Ancistrocerus unifasciatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

WetlandTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 16.4–21.4

Seasonal swing summer↔winter28.2 °C

Max temp (day)25.0 °C 22.1–25.9

Min temp (night)15.6 °C 11.1–18.9

Precipitation86.8 mm/mo 68.3–97.1

Air humidity57.8 % 56.4–59.3

Moisture balance-62.6 mm/mo -91.1–-44.1

Vapour deficit976 Pa 820–1,057

Wind speed3.30 m/s 2.50–5.50

Cloud cover40.9 % 32.6–46.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)