Ancistrocerus nigricornis

(Curtis, 1826) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Vespidae/Ancistrocerus

At a glance

Occurrence records9 227

Data sources7

Biological traits2

DNA specimens51

eDNA detections52

Sources7 archives

Databases and archives Ancistrocerus nigricornis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 227 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI52 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics51 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF9 227 records

Environmental DNA2 datasets · 10 countries52 detections

DNA & barcodingBOLD51 specimens

Genome at a glanceGoaT≈232 Mbp

01Narrative

Ancistrocerus nigricornis is a species of potter wasp.Catalogue of life

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)parasitoid

05DNA & barcoding51 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancistrocerus nigricornis has left across the world's sequence archives.

At a glance

DNA specimens51

BINs1

Marker genes2

eDNA detections52

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus48 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.01%

Haplotypes2

BIN1

Most divergent pair0.15%

TTTACTTTATTTTATTTTTGGAATTTGATCTGGAATAATTGGGTCAGCTTTAAGAATAATTATTCGGTTAGAATTAGGAACCCCAGGTAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancistrocerus longispinosussame genus7.8%Ancistrocerus trifasciatussame genus7.9%Ancistrocerus scoticussame genus8.1%Ancistrocerus albophaleratussame genus8.1%Ancistrocerus parietumsame genus8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT

The complete instruction manual Ancistrocerus nigricornis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈231 995 547 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Ancistrocerus nigricornis0.23 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 121×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness96.1% BUSCO

08Occurrence & distribution

Record type9 227 records

Wild obs. + sensor3 580

Museum / vouchered5 447

Cultivated / captive2

Other198

Origin

Native1 482

Range

Area of Occupancy AOO12 928 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 1 054≤1 km 1 080≤10 km 981>10 km 6

3 121 georeferenced · 459 without coordinates

Open the mapobservation + sensor3 580

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 230≤1 km 1 026≤10 km 3 360>10 km 298

4 914 georeferenced · 533 without coordinates

Open the institutions mapphysical evidence5 447

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	1 030
Bern, CH	760
Zürich, CH	562
Paro, BT	478
Muzeum Górnośląskie w Bytomiulocation not on record	296
Natural History Museum Rotterdamlocation not on record	252
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	184
Geneva, CH	178
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	174
Musee d'Histoire Naturallelocation not on record	120
Helsinki, FI	118
SLU Artdatabankenlocation not on record	107
NMOKlocation not on record	74
Tilburg, NL	45
Frauenfeld, CH	45
Philadelphia, US	24
Trondheim, NO	24
BioFokuslocation not on record	23
Universität Zürich, Naturhistorisches Museumlocation not on record	23
Bonn, DE	20
NHMOlocation not on record	20
ZSMlocation not on record	17
NCMGlocation not on record	14
Winterthur, CH	11
Uniwersytet Łódzkilocation not on record	11
Museum zu Allerheiligen Schaffhausenlocation not on record	8
Naturmuseum Solothurnlocation not on record	8
Naturkundliche Sammlung Urilocation not on record	8
neflocation not on record	7
MZLUlocation not on record	6
CBDClocation not on record	5
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	4
Sion, CH	4
Stockholm, SE	3
Gothenburg, SE	2
PRAZlocation not on record	2
Dhaka, BD	2

37 institutions · 4 669 of 5 447 vouchered records shown · 778 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA52 detections

Where the DNA of Ancistrocerus nigricornis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found52

Studies independent surveys2

Countries10

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 52 detections have coordinates

Open the map10 countries0

light forest pathorganic farm1.1. Boreal Forest|1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 7.80–20.0

Seasonal swing summer↔winter18.6 °C

Max temp (day)21.2 °C 11.1–24.2

Min temp (night)12.3 °C 2.80–15.0

Precipitation68.2 mm/mo 51.0–119

Air humidity59.0 % 56.3–62.3

Moisture balance-30.3 mm/mo -70.4–9.30

Vapour deficit784 Pa 424–1,010

Wind speed3.20 m/s 2.30–3.90

Cloud cover36.5 % 33.2–45.8

CHELSA 1981–2010, ~9 km grid, at location & month of 46 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ancistrocerus nigricornis

At a glance

Sources7 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type9 227 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 37 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 227 records