Ancistrocerus albophaleratus

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Vespidae/Ancistrocerus

At a glance

Occurrence records602

Data sources6

Biological traits0

DNA specimens96

eDNA detections21

Sources6 archives

Databases and archives Ancistrocerus albophaleratus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility602 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics96 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF602 records

Environmental DNA1 datasets · 2 countries21 detections

DNA & barcodingBOLD96 specimens

01Narrative

Ancistrocerus albophaleratus (лат.) — вид одиночных ос из семейства Vespidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding96 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancistrocerus albophaleratus has left across the world's sequence archives.

At a glance

DNA specimens96

BINs5

Marker genes1

eDNA detections21

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus93 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 56 variable positions, in barcode order

1Amostly conserved

2Tmostly conserved

19Cmostly conserved

25Tmostly conserved

31Tmostly conserved

34Amostly conserved

43Avariable

49Cmostly conserved

55Amostly conserved

67Tmostly conserved

92Tvariable

118Tvariable

124Tmostly conserved

133Tvariable

139Amostly conserved

154Tvariable

172Tmostly conserved

181Amostly conserved

196Amostly conserved

220Cvariable

235Tmostly conserved

259Cmostly conserved

278Cmostly conserved

284Cmostly conserved

322Amostly conserved

340Tvariable

367Tvariable

373Tvariable

385Tmostly conserved

394Tmostly conserved

403Amostly conserved

415Tmostly conserved

445Tmostly conserved

457Tvariable

469Tvariable

517Tvariable

547Tvariable

553Tvariable

557Tmostly conserved

565Amostly conserved

571Tmostly conserved

589Tmostly conserved

592Amostly conserved

595Cmostly conserved

598Tmostly conserved

604Tmostly conserved

613Tmostly conserved

616Tmostly conserved

622Tmostly conserved

628Tmostly conserved

631Tmostly conserved

634Cmostly conserved

643Tmostly conserved

646Cvariable

653Tvariable

658Tmostly conserved

ATTATTATATTTTATTTTCGGAATTTGATCTGGAATAATTGGATCAGCCTTAAGAATAATTATTCGTTTAGAACTTGGAACTCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes33

BINs5

Most divergent pair6.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancistrocerus parietumsame genus4.0%Ancistrocerus trifasciatussame genus5.5%Ancistrocerus longispinosussame genus6.1%Ancistrocerus gazellasame genus6.7%Ancistrocerus adiabatussame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type602 records

Wild obs. + sensor278

Museum / vouchered324

Range

Area of Occupancy AOO1 468 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 148≤1 km 51≤10 km 19>10 km 18

236 georeferenced · 42 without coordinates

Open the mapobservation + sensor278

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 178≤1 km 8≤10 km 11

197 georeferenced · 127 without coordinates

Open the institutions mapphysical evidence324

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	195
University of Guelph, Centre for Biodiversity Genomicslocation not on record	27
US	25
WIlocation not on record	18
University of Guelphlocation not on record	14
St. Paul, US	6
Royal Alberta Museumlocation not on record	1

7 institutions · 286 of 324 vouchered records shown · 38 without an institution code

09Environmental DNA21 detections

Where the DNA of Ancistrocerus albophaleratus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map2 countries0

roadsidehighbush blueberry cropsedge of woodsMixed HabitatGrassland1. Forest & Woodland|1.1 Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.9 °C 13.8–20.1

Seasonal swing summer↔winter26.1 °C

Max temp (day)22.7 °C 18.7–25.2

Min temp (night)13.6 °C 10.0–15.7

Precipitation88.1 mm/mo 78.1–106

Air humidity58.9 % 56.7–63.4

Moisture balance-50.9 mm/mo -67.3–-3.80

Vapour deficit846 Pa 678–967

Wind speed3.50 m/s 2.20–4.10

Cloud cover40.7 % 36.2–44.9

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)