Ancistrocerus longispinosus

(de Saussure, 1855) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Vespidae/Ancistrocerus

At a glance

Occurrence records301

Data sources7

Biological traits0

DNA specimens6

eDNA detections7

Sources7 archives

Databases and archives Ancistrocerus longispinosus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility301 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF301 records

Environmental DNA1 datasets · 4 countries7 detections

DNA & barcodingBOLD6 specimens

01Narrative

Ancistrocerus longispinosus is a species of potter wasp, belonging to the family Vespidae, subfamily Eumeninae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancistrocerus longispinosus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections7

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.45%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 8 variable positions, in barcode order

88Tmostly conserved

115Tmostly conserved

265Amostly conserved

301Tmostly conserved

373Cmostly conserved

409Cvariable

544Gmostly conserved

622Amostly conserved

ATTACTTTATTTTATTTTTGGAATTTGATCTGGAATAATTGGATCAGCTTTAAGAATAATTATTCGATTAGAACTTGGAACTCCAGGTAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancistrocerus trifasciatussame genus4.3%Ancistrocerus scoticussame genus6.1%Ancistrocerus albophaleratussame genus6.1%Ancistrocerus gazellasame genus6.2%Ancistrocerus parietumsame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type301 records

Wild obs. + sensor65

Museum / vouchered234

Other2

Origin

Native10

Range

Area of Occupancy AOO712 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 9≤1 km 9≤10 km 4>10 km 4

26 georeferenced · 39 without coordinates

Open the mapobservation + sensor65

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤1 km 99≤10 km 84>10 km 38

221 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence234

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	98
Provincia di Livornolocation not on record	97
IMEDEAlocation not on record	10
Philadelphia, US	8
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	4
Muzeum Górnośląskie w Bytomiulocation not on record	3
Paro, BT	2
Geneva, CH	2
Musee d'Histoire Naturallelocation not on record	2
UGRlocation not on record	1

10 institutions · 227 of 234 vouchered records shown · 7 without an institution code

09Environmental DNA7 detections

Where the DNA of Ancistrocerus longispinosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map4 countries0

Chablis chenaie

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.6 °C 9.00–21.9

Seasonal swing summer↔winter19.5 °C

Max temp (day)23.1 °C 13.1–26.9

Min temp (night)13.2 °C 3.10–15.8

Precipitation95.1 mm/mo 13.3–181

Air humidity55.2 % 43.0–60.3

Moisture balance-26.5 mm/mo -162–46.3

Vapour deficit981 Pa 465–1,450

Wind speed1.90 m/s 1.70–3.40

Cloud cover37.4 % 24.8–39.2

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)