Ancistrocerus campestris

(de Saussure, 1853) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Vespidae/Ancistrocerus

At a glance

Occurrence records2 403

Data sources7

Biological traits0

DNA specimens3

eDNA detections2

Sources7 archives

Databases and archives Ancistrocerus campestris's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 403 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 403 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD3 specimens

01Narrative

Ancistrocerus campestris is a species of potter wasp. Adults grow up to 10 mm in length.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancistrocerus campestris has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

ATTACTTTATTTTATTTTTGGTTTATGATCTGGAATAATTGGATCTGCTTTAAGAATAATTATTCGATTAGAATTAGGAACCCCAGATAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancistrocerus lineativentrissame genus5.0%Ancistrocerus longispinosussame genus11.2%Ancistrocerus trifasciatussame genus11.4%Ancistrocerus ichneumonideussame genus11.9%Ancistrocerus scoticussame genus12.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 403 records

Wild obs. + sensor2 085

Museum / vouchered318

Range

Area of Occupancy AOO6 420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 1 116≤1 km 292≤10 km 91>10 km 232

1 731 georeferenced · 354 without coordinates

Open the mapobservation + sensor2 085

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤1 km 40≤10 km 54

94 georeferenced · 224 without coordinates

Open the institutions mapphysical evidence318

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	95
Champaign, US	91
University of Guelphlocation not on record	70
Chicago, US	31
University Park, US	10
Provincia di Livornolocation not on record	4
University of Central Floridalocation not on record	4
Cambridge, US	3
WIlocation not on record	2
CUlocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
LULlocation not on record	1
Toronto, CA	1

13 institutions · 314 of 318 vouchered records shown · 4 without an institution code

09Environmental DNA2 detections

Where the DNA of Ancistrocerus campestris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.4 °C 18.0–22.8

Seasonal swing summer↔winter30.9 °C

Max temp (day)24.6 °C 23.6–25.6

Min temp (night)17.2 °C 13.6–20.8

Precipitation92.7 mm/mo 90.9–94.4

Air humidity58.7 % 58.1–59.3

Moisture balance-58.9 mm/mo -82.4–-35.4

Vapour deficit1000 Pa 868–1,132

Wind speed3.90 m/s 2.70–5.10

Cloud cover41.9 % 37.8–45.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ancistrocerus campestris

At a glance

Sources7 archives

At a glance

Record type2 403 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 403 records