Ancistrocerus albolacteus

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Vespidae/Ancistrocerus

At a glance

Occurrence records64

Data sources6

Biological traits0

DNA specimens31

eDNA detections37

Sources6 archives

Databases and archives Ancistrocerus albolacteus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility64 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF64 records

Environmental DNA1 datasets · 2 countries37 detections

DNA & barcodingBOLD31 specimens

01Narrative

Ancistrocerus albolacteus (лат.) — вид одиночных ос из семейства Vespidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancistrocerus albolacteus has left across the world's sequence archives.

At a glance

DNA specimens31

BINs2

Marker genes1

eDNA detections37

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

1Cmostly conserved

31Tmostly conserved

79Tmostly conserved

82Tmostly conserved

196Amostly conserved

322Amostly conserved

340Cmostly conserved

364Cmostly conserved

370Cmostly conserved

400Cmostly conserved

401Tmostly conserved

403Amostly conserved

406Tmostly conserved

415Tmostly conserved

508Cmostly conserved

553Tmostly conserved

565Amostly conserved

580Tmostly conserved

601Cmostly conserved

607Amostly conserved

628Amostly conserved

634Cmostly conserved

646Tmostly conserved

CTTACTTTATTTTATTTTTGGAATTTGATCTGGAATAATTGGATCAGCTTTAAGAATAATTATTCGTTTAGAATTAGGTACTCCAGGTAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.50%

Haplotypes4

BINs2

Most divergent pair3.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancistrocerus adiabatussame genus3.3%Ancistrocerus scoticussame genus6.8%Ancistrocerus trifasciatussame genus6.8%Ancistrocerus albophaleratussame genus6.8%Ancistrocerus longispinosussame genus7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type64 records

Wild obs. + sensor30

Museum / vouchered34

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 11≤1 km 2≤10 km 3>10 km 4

20 georeferenced · 10 without coordinates

Open the mapobservation + sensor30

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 13≤1 km 5≤10 km 1

19 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	18
University of Guelph, Centre for Biodiversity Genomicslocation not on record	10
US	5
WIlocation not on record	1

4 institutions · 34 of 34 vouchered records shown

09Environmental DNA37 detections

Where the DNA of Ancistrocerus albolacteus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map2 countries0

slopesdunes4. Native GrasslandGrasslandMixed HabitatPost-fire forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 13.0–20.7

Seasonal swing summer↔winter24.9 °C

Max temp (day)22.9 °C 19.7–28.0

Min temp (night)10.8 °C 5.90–14.5

Precipitation66.3 mm/mo 21.9–112

Air humidity52.6 % 50.6–57.1

Moisture balance-63.6 mm/mo -104–-23.1

Vapour deficit831 Pa 684–1,178

Wind speed2.40 m/s 1.60–3.70

Cloud cover33.8 % 20.1–37.1

CHELSA 1981–2010, ~9 km grid, at location & month of 37 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)