Ancistrocerus catskill

(de Saussure, 1853) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Vespidae/Ancistrocerus

At a glance

Occurrence records901

Data sources6

Biological traits0

DNA specimens20

eDNA detections24

Sources6 archives

Databases and archives Ancistrocerus catskill's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility901 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF901 records

Environmental DNA1 datasets · 2 countries24 detections

DNA & barcodingBOLD20 specimens

01Narrative

Ancistrocerus catskill (лат.) — вид одиночных ос из семейства Vespidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancistrocerus catskill has left across the world's sequence archives.

At a glance

DNA specimens20

BINs2

Marker genes2

eDNA detections24

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 31 variable positions, in barcode order

2Tmostly conserved

4Amostly conserved

5Cmostly conserved

6Tmostly conserved

28Gmostly conserved

43Amostly conserved

115Tmostly conserved

121Cmostly conserved

127Tmostly conserved

133Cmostly conserved

184Amostly conserved

190Tmostly conserved

193Tmostly conserved

265Amostly conserved

286Cmostly conserved

290Cmostly conserved

302Cmostly conserved

310Amostly conserved

319Tmostly conserved

343Tmostly conserved

355Amostly conserved

376Amostly conserved

391Amostly conserved

394Cmostly conserved

430Amostly conserved

439Cmostly conserved

490Cmostly conserved

578Tmostly conserved

595Tmostly conserved

598Cmostly conserved

643Tmostly conserved

ATTACTTTATTTTATTTTTGGACTTTGGGCAGGAATAATTGGATCAGCTTTAAGAATAATTATTCGACTAGAATTAGGAACCCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.60%

Haplotypes3

BINs2

Most divergent pair4.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancistrocerus spilogastersame genus3.6%Ancistrocerus longispinosussame genus8.2%Ancistrocerus durangoensissame genus8.4%Ancistrocerus trifasciatussame genus8.5%Ancistrocerus waldeniisame genus8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type901 records

Wild obs. + sensor704

Museum / vouchered197

Range

Area of Occupancy AOO2 236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 423≤1 km 104≤10 km 25>10 km 71

623 georeferenced · 81 without coordinates

Open the mapobservation + sensor704

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 9≤1 km 64≤10 km 23>10 km 4

100 georeferenced · 97 without coordinates

Open the institutions mapphysical evidence197

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidad Católica de Manizaleslocation not on record	68
WIlocation not on record	29
University of Guelphlocation not on record	22
Chicago, US	20
US	18
Provincia di Livornolocation not on record	7
Edmonton, CA	7
Colorado State Universitylocation not on record	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
ASUlocation not on record	2
Albuquerque, US	1
CUlocation not on record	1
Natural History Museum of Utahlocation not on record	1
Cambridge, US	1
University Park, US	1

15 institutions · 185 of 197 vouchered records shown · 12 without an institution code

09Environmental DNA24 detections

Where the DNA of Ancistrocerus catskill was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map2 countries0

WetlandTemperate mixed forestForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.8 °C 15.1–19.5

Seasonal swing summer↔winter27.3 °C

Max temp (day)21.3 °C 20.0–26.1

Min temp (night)13.2 °C 11.6–16.6

Precipitation80.3 mm/mo 35.5–111

Air humidity60.2 % 51.1–62.1

Moisture balance-52.0 mm/mo -88.2–18.5

Vapour deficit784 Pa 682–1,017

Wind speed4.00 m/s 2.70–5.90

Cloud cover43.3 % 33.7–48.2

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)