Ancistrocerus spilogaster

Cameron, 1905 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Vespidae/Ancistrocerus

At a glance

Occurrence records24

Data sources6

Biological traits0

DNA specimens3

eDNA detections1

Sources6 archives

Databases and archives Ancistrocerus spilogaster's data was compiled from.

GBIFGlobal Biodiversity Information Facility24 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF24 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD3 specimens

Genome at a glanceTreeOfSex2n = 12

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancistrocerus spilogaster has left across the world's sequence archives.

At a glance

DNA specimens3

BINs2

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)3.3%

Haplotypes2

BINs2

Most divergent pair1.5%

Where individuals differ — all 29 variable positions, in barcode order

1Avariable

7Tvariable

19Tvariable

28Gvariable

29Gvariable

40Tvariable

43Tvariable

68Cvariable

73Avariable

82Cvariable

98Gvariable

99Gvariable

106Tvariable

112Cvariable

127Avariable

136Cvariable

154Cvariable

157Tvariable

169Tvariable

172Tvariable

181Avariable

184Avariable

190Cvariable

250Cvariable

310Avariable

376Avariable

430Avariable

616Cvariable

634Cvariable

ATTACTTTATTTTATTTTTGGACTTTGGGCAGGAATAATTGGTTCAGCTTTAAGAATAATTATTCGACTAGAATTAGGAACCCCAGGAAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancistrocerus catskillsame genus3.6%Ancistrocerus trifasciatussame genus7.4%Ancistrocerus durangoensissame genus7.6%Ancistrocerus longispinosussame genus8.1%Ancistrocerus scoticussame genus9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceTreeOfSex

The complete instruction manual Ancistrocerus spilogaster carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 121×TreeOfSex · invert

TreeOfSex · invert — Gokhman, V. E. "Karyotypes of parasitic Hymenoptera: evolution, systematic and phylogenetic implications." Unpublished D. Sc. thesis. Moscow: Moscow State University (2003). ↗

08Occurrence & distribution

Record type24 records

Wild obs. + sensor9

Museum / vouchered15

Range

Area of Occupancy AOO76 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 5≤1 km 2>10 km 2

9 georeferenced

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 1≤1 km 7≤10 km 3

11 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	5
Zürich, CH	3
University of Central Floridalocation not on record	2
Natural History Museum of Utahlocation not on record	1
ASUlocation not on record	1
California Department for Food and Agriculturelocation not on record	1
Champaign, US	1
	1

8 institutions · 15 of 15 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Ancistrocerus spilogaster was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 12.7–12.7

Seasonal swing summer↔winter18.7 °C

Max temp (day)19.7 °C

Min temp (night)5.70 °C

Precipitation29.1 mm/mo

Air humidity48.8 %

Moisture balance-126 mm/mo

Vapour deficit755 Pa

Wind speed2.60 m/s

Cloud cover26.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)