Ancistrocerus waldenii

(Viereck, 1906) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Vespidae/Ancistrocerus

At a glance

Occurrence records291

Data sources6

Biological traits0

DNA specimens21

eDNA detections26

Sources6 archives

Databases and archives Ancistrocerus waldenii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility291 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF291 records

Environmental DNA3 datasets · 3 countries26 detections

DNA & barcodingBOLD21 specimens

01Narrative

Ancistrocerus adiabatus (лат.) — вид одиночных ос из семейства Vespidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancistrocerus waldenii has left across the world's sequence archives.

At a glance

DNA specimens21

BINs3

Marker genes1

eDNA detections26

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Diversity (π)2.7%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 57 variable positions, in barcode order

1Tmostly conserved

20Gmostly conserved

23Amostly conserved

28Amostly conserved

29Tmostly conserved

31Tmostly conserved

68Tmostly conserved

74Cmostly conserved

100Amostly conserved

121Tmostly conserved

130Tmostly conserved

136Tmostly conserved

154Tmostly conserved

163Cmostly conserved

181Tmostly conserved

190Amostly conserved

202Tmostly conserved

205Amostly conserved

226Cmostly conserved

256Tmostly conserved

259Cmostly conserved

274Amostly conserved

281Tmostly conserved

286Tmostly conserved

290Tmostly conserved

301Cmostly conserved

302Tmostly conserved

305Gmostly conserved

310Gmostly conserved

343Cmostly conserved

361Tmostly conserved

370Tmostly conserved

373Cmostly conserved

385Tmostly conserved

389Amostly conserved

394Tmostly conserved

397Cmostly conserved

412Tmostly conserved

433Amostly conserved

445Cmostly conserved

451Amostly conserved

481Amostly conserved

485Cmostly conserved

490Tmostly conserved

499Tmostly conserved

539Tmostly conserved

541Amostly conserved

542Gmostly conserved

571Cmostly conserved

578Cmostly conserved

598Tmostly conserved

604Tmostly conserved

607Cmostly conserved

610Cmostly conserved

619Tmostly conserved

625Amostly conserved

631Amostly conserved

TTTACTTTATTTTATTTTTGGAATTTGATCTGGAATAATTGGATCAGCTTTAAGAATAATTATTCGATTAGAACTAGGAACCCCAGGAAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancistrocerus longispinosussame genus7.4%Ancistrocerus gazellasame genus7.6%Ancistrocerus trifasciatussame genus7.6%Ancistrocerus adiabatussame genus8.2%Ancistrocerus albophaleratussame genus8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type291 records

Wild obs. + sensor258

Museum / vouchered33

Range

Area of Occupancy AOO920 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 121≤1 km 62≤10 km 11>10 km 27

221 georeferenced · 37 without coordinates

Open the mapobservation + sensor258

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 2≤1 km 4≤10 km 6>10 km 2

14 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidad Católica de Manizaleslocation not on record	6
Edmonton, CA	5
US	3
Copenhagen, DK	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Colorado State Universitylocation not on record	2
St. Paul, US	2
Provincia di Livornolocation not on record	1
University of Copenhagenlocation not on record	1

9 institutions · 25 of 33 vouchered records shown · 8 without an institution code

09Environmental DNA26 detections

Where the DNA of Ancistrocerus waldenii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys3

Countries3

Verifiable raw sequence linked7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map3 countries0

1. Forest & Woodland | 1.1 Boreal ForestAgricultural field1. Forest & Woodland | 1.4. Temperate Forest4. Native Grassland | 4.4. Temperate Grasslandat bluffs, Elev: 620-660

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.7 °C 10.7–16.1

Seasonal swing summer↔winter27.2 °C

Max temp (day)17.2 °C 14.5–20.4

Min temp (night)7.90 °C 5.20–11.2

Precipitation67.2 mm/mo 50.4–107

Air humidity56.5 % 52.3–62.2

Moisture balance-44.2 mm/mo -74.3–12.5

Vapour deficit645 Pa 520–775

Wind speed3.30 m/s 2.20–4.30

Cloud cover45.7 % 36.2–73.7

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)