Anaspis maculata

Geoffroy, 1785 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scraptiidae/Anaspis

At a glance

Occurrence records10 792

Data sources10

Biological traits0

DNA specimens175

eDNA detections237

Sources10 archives

Databases and archives Anaspis maculata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 792 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI237 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics175 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF10 792 records

Environmental DNA5 datasets · 9 countries237 detections

DNA & barcodingBOLD175 specimens

Genome at a glanceGoaT · NCBI≈758 Mbp

01Narrative

Mordella pallida is a species of beetle in the genus Mordella of the family Mordellidae, which is part of the superfamily Tenebrionoidea. It was discovered in 1895.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding175 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaspis maculata has left across the world's sequence archives.

At a glance

DNA specimens175

BINs1

Marker genes3

eDNA detections237

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus168 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

CTCTTTATTTTCTCTTTGGCGCTTGATCAGGAATAGTAGGAACTTCCCTCAGTCTACTAATTCGATCAGAGCTAGGTACTCCAGGCTCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.26%

Haplotypes6

BIN1

Most divergent pair0.31%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anaspis luridasame genus12.8%Anaspis atratasame genus13.4%Anaspis ruficollissame genus13.6%Anaspis flavipennissame genus13.9%Anaspis frontalissame genus14.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anaspis maculata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈757 828 000 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anaspis maculata0.76 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.5% BUSCO

08Occurrence & distribution

Record type10 792 records

Wild obs. + sensor9 206

Museum / vouchered341

Fossil14

Other1 231

Range

Area of Occupancy AOO18 164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 3 974≤1 km 1 981≤10 km 2 618>10 km 125

8 698 georeferenced · 508 without coordinates

Open the mapobservation + sensor9 206

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 71≤1 km 72≤10 km 106>10 km 3

252 georeferenced · 89 without coordinates

Open the institutions mapphysical evidence341

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	56
NCMGlocation not on record	35
Tilburg, NL	34
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	22
Natural History Museum Rotterdamlocation not on record	17
ZSMlocation not on record	12
CBDClocation not on record	10
South Kensington, GB	10
NMOKlocation not on record	9
Ugentlocation not on record	6
Paris, FR	4
Museu Nacional de História Natural e da Ciêncialocation not on record	4
NTNU-VMlocation not on record	2
BioFokuslocation not on record	2
Helsinki, FI	2
Natural History Museum, Londonlocation not on record	2
Provincia di Livornolocation not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Universite de Montpellierlocation not on record	1
MZLUlocation not on record	1

21 institutions · 232 of 341 vouchered records shown · 109 without an institution code

09Environmental DNA237 detections

Where the DNA of Anaspis maculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found237

Studies independent surveys5

Countries9

Verifiable raw sequence linked37

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 237 detections have coordinates

Open the map9 countries0

UrbanMediterranean chaparral1. Forest & Woodland|1.4. Temperate Forestmerenranta, aurinkoinen metsAÂ¤nreunaLaubwald1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 10.9–16.0

Seasonal swing summer↔winter16.2 °C

Max temp (day)17.6 °C 13.4–19.0

Min temp (night)9.40 °C 6.70–12.4

Precipitation65.1 mm/mo 48.6–108

Air humidity60.4 % 59.4–62.3

Moisture balance-40.5 mm/mo -63.1–0.8

Vapour deficit623 Pa 484–691

Wind speed4.10 m/s 2.20–5.10

Cloud cover39.9 % 35.7–49.0

CHELSA 1981–2010, ~9 km grid, at location & month of 233 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anaspis maculata

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type10 792 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type10 792 records