Anarta pugnax

Hübner, 1824 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Anarta

At a glance

Occurrence records809

Data sources6

Biological traits0

DNA specimens3

eDNA detections1

Sources6 archives

Databases and archives Anarta pugnax's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility809 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF809 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD3 specimens

01Narrative

Anarta pugnax is een vlinder uit de familie uilen (Noctuidae). De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1824 door Hübner. De soort komt voor in Europa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anarta pugnax has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.9%

Haplotypes1

BIN1

Where individuals differ — all 18 variable positions, in barcode order

22Avariable

81Cvariable

85Cvariable

127Tvariable

200Avariable

202Tvariable

241Gvariable

247Tvariable

287Cvariable

355Cvariable

400Cvariable

418Cvariable

424Cvariable

526Avariable

553Avariable

610Tvariable

634Tvariable

652Cvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAACCCCCGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anarta columbicasame genus2.7%Anarta hamatasame genus2.7%Anarta odontitessame genus2.9%Anarta trifoliisame genus3.0%Anarta farnhamisame genus3.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type809 records

Wild obs. + sensor392

Museum / vouchered46

Other371

Origin

Native14

Range

Area of Occupancy AOO1 448 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 127≤1 km 52≤10 km 27>10 km 10

216 georeferenced · 176 without coordinates

Open the mapobservation + sensor392

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 6

6 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence46

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UMUlocation not on record	32
Helsinki, FI	5
Tallinn, EE	3
Bavarian State Collection of Zoologylocation not on record	1

4 institutions · 41 of 46 vouchered records shown · 5 without an institution code

09Environmental DNA1 detections

Where the DNA of Anarta pugnax was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 18.1–18.1

Seasonal swing summer↔winter19.5 °C

Max temp (day)22.5 °C

Min temp (night)13.5 °C

Precipitation92.6 mm/mo

Air humidity58.7 %

Moisture balance-24.8 mm/mo

Vapour deficit863 Pa

Wind speed1.70 m/s

Cloud cover32.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)