Anarta odontites

Boisduval, 1829 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Anarta

At a glance

Occurrence records746

Data sources7

Biological traits0

DNA specimens35

eDNA detections33

Sources7 archives

Databases and archives Anarta odontites's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility746 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF746 records

Environmental DNA1 datasets · 7 countries33 detections

DNA & barcodingBOLD35 specimens

01Narrative

Hadula odontites is a moth of the family Noctuidae. It is found from the Iberian Peninsula through central and southern Europa, east up to Ukraine. In the south it is found in the Mediterranean Sea area and Asia Minor, northern Iran, southern Russia, up to Mongolia. The wingspan is 30–36 mm. Adults are on wing from April to June and from July to September in two generations. On higher altitudes there is only one generation. The larvae feed on the leaves of Hippocrepis comosa. Adults feed on the nectar of Thymus, Origanum vulgare and Lotus corniculatus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anarta odontites has left across the world's sequence archives.

At a glance

DNA specimens35

BINs2

Marker genes1

eDNA detections33

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

103Tmostly conserved

190Cmostly conserved

206Cmostly conserved

274Cmostly conserved

312Gmostly conserved

415Tmostly conserved

421Amostly conserved

424Cmostly conserved

442Cmostly conserved

484Tmostly conserved

529Gmostly conserved

542Cmostly conserved

586Cmostly conserved

616Tmostly conserved

637Cmostly conserved

653Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.32%

Haplotypes3

BINs2

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anarta obesulasame genus2.8%Anarta pugnaxsame genus2.9%Anarta altasame genus2.9%Anarta inconcinnasame genus3.0%Anarta columbicasame genus3.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type746 records

Wild obs. + sensor531

Museum / vouchered141

Other74

Range

Area of Occupancy AOO1 480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 291≤1 km 123≤10 km 48>10 km 5

467 georeferenced · 64 without coordinates

Open the mapobservation + sensor531

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 31≤1 km 66≤10 km 13

110 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence141

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Salzburg, AT	77
UMUlocation not on record	16
DABUHlocation not on record	15
Provincia di Livornolocation not on record	8
Tartu, EE	4
Uniwersytet Łódzkilocation not on record	3
ZSMlocation not on record	2
NMOKlocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Research Collection of Gabriele Fiumilocation not on record	1

10 institutions · 129 of 141 vouchered records shown · 12 without an institution code

09Environmental DNA33 detections

Where the DNA of Anarta odontites was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.7 °C 7.60–17.8

Seasonal swing summer↔winter19.5 °C

Max temp (day)17.8 °C 12.0–22.1

Min temp (night)8.10 °C 2.00–13.1

Precipitation101 mm/mo 49.0–222

Air humidity58.7 % 55.1–64.2

Moisture balance-27.2 mm/mo -76.8–112

Vapour deficit630 Pa 375–893

Wind speed2.90 m/s 1.50–6.10

Cloud cover37.6 % 35.2–40.8

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)