Anarta farnhami

Grote, 1873 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Anarta

At a glance

Occurrence records463

Data sources7

Biological traits0

DNA specimens51

eDNA detections63

Sources7 archives

Databases and archives Anarta farnhami's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility463 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI63 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics51 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF463 records

Environmental DNA1 datasets · 9 countries63 detections

DNA & barcodingBOLD51 specimens

01Narrative

Anarta farnhami is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Anarta farnhami is 10232.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding51 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anarta farnhami has left across the world's sequence archives.

At a glance

DNA specimens51

BINs1

Marker genes1

eDNA detections63

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus51 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

31Tmostly conserved

59Cmostly conserved

200Amostly conserved

304Cmostly conserved

400Cmostly conserved

424Cmostly conserved

451Tmostly conserved

475Tmostly conserved

526Tmostly conserved

616Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCATTAAGATTACTAATTCGAGCTGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes4

BIN1

Most divergent pair1.7%

N.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anarta collettisame genus1.5%Anarta furcasame genus1.8%Anarta sabulorumsame genus2.4%Protomiselia bilineasame family3.0%Anarta inconcinnasame genus3.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type463 records

Wild obs. + sensor92

Museum / vouchered371

Range

Area of Occupancy AOO868 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 36≤1 km 19≤10 km 16>10 km 3

74 georeferenced · 18 without coordinates

Open the mapobservation + sensor92

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 34≤1 km 29≤10 km 29>10 km 2

94 georeferenced · 277 without coordinates

Open the institutions mapphysical evidence371

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	163
Colorado State Universitylocation not on record	88
University of Guelph, Centre for Biodiversity Genomicslocation not on record	26
Royal Saskatchewan Museumlocation not on record	25
Helsinki, FI	10
East Lansing, US	6
St. Paul, US	4
Vernal, US	3
Oregon State Arthropod Collectionlocation not on record	3
Cornell University Insect Collectionlocation not on record	1
ASUlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

12 institutions · 331 of 371 vouchered records shown · 40 without an institution code

09Environmental DNA63 detections

Where the DNA of Anarta farnhami was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found63

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 63 detections have coordinates

Open the map9 countries0

1. Forest & Woodland|1.2 Subarctic ForestTundraForestIntertidal

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.2 °C 10.0–14.0

Seasonal swing summer↔winter37.0 °C

Max temp (day)14.2 °C 14.2–21.2

Min temp (night)7.00 °C 4.50–8.70

Precipitation88.0 mm/mo 29.5–96.1

Air humidity62.6 % 48.0–62.6

Moisture balance-15.7 mm/mo -122–10.2

Vapour deficit466 Pa 466–881

Wind speed3.50 m/s 2.30–4.10

Cloud cover44.2 % 21.8–50.8

CHELSA 1981–2010, ~9 km grid, at location & month of 63 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)