Anania verbascalis

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Anania

At a glance

Occurrence records6 755

Data sources9

Biological traits0

DNA specimens93

eDNA detections89

Sources9 archives

Databases and archives Anania verbascalis's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 755 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI89 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics93 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF6 755 records

Environmental DNA1 datasets · 19 countries89 detections

DNA & barcodingBOLD93 specimens

Genome at a glanceGoaT · NCBI≈496 Mbp

01Narrative

Anania verbascalis is a species of moth of the family Crambidae. It is found in Europe. The wingspan is 22–26 mm. The moth flies from June to August depending on the location. Fig.2 larva after final moult The larvae feed on Teucrium scorodonia and Verbascum thapsus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding93 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anania verbascalis has left across the world's sequence archives.

At a glance

DNA specimens93

BINs6

Marker genes1

eDNA detections89

Countries22

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus89 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 49 variable positions, in barcode order

76Amostly conserved

88Cmostly conserved

112Tmostly conserved

133Tmostly conserved

136Tmostly conserved

184Tmostly conserved

196Amostly conserved

205Tmostly conserved

235Cmostly conserved

241Amostly conserved

250Tmostly conserved

266Cmostly conserved

271Amostly conserved

274Gvariable

334Amostly conserved

346Amostly conserved

361Tmostly conserved

364Cmostly conserved

368Gmostly conserved

370Tmostly conserved

382Amostly conserved

394Tmostly conserved

400Cmostly conserved

401Cmostly conserved

415Tmostly conserved

427Cmostly conserved

433Amostly conserved

442Cmostly conserved

451Tmostly conserved

463Tmostly conserved

478Amostly conserved

484Amostly conserved

499Amostly conserved

508Amostly conserved

514Tmostly conserved

523Cmostly conserved

526Amostly conserved

536Tmostly conserved

547Tmostly conserved

557Cvariable

562Tmostly conserved

565Tmostly conserved

581Tmostly conserved

589Tmostly conserved

616Tmostly conserved

625Amostly conserved

628Gvariable

646Cmostly conserved

653Cmostly conserved

TACTTTATATTTTATTTTTGGAATTTGAAGAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGTAATCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes15

BINs6

Most divergent pair2.7%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anania funebrissame genus5.8%Anania labeculalissame genus5.9%Anania teneralissame genus6.4%Anania crocealissame genus6.7%Anania flavasame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anania verbascalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈495 566 654 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anania verbascalis0.50 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.8% BUSCO

08Occurrence & distribution

Record type6 755 records

Wild obs. + sensor5 839

Museum / vouchered836

Other80

Origin

Native2

Range

Area of Occupancy AOO12 572 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 1 997≤1 km 868≤10 km 1 620>10 km 85

4 570 georeferenced · 1 269 without coordinates

Open the mapobservation + sensor5 839

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 211≤1 km 252≤10 km 211>10 km 10

684 georeferenced · 152 without coordinates

Open the institutions mapphysical evidence836

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	337
Provincia di Livornolocation not on record	124
Zürich, CH	51
Tartu, EE	42
Nijmegen, NL	32
Helsinki, FI	25
SLU Artdatabankenlocation not on record	17
NHMOlocation not on record	12
Natural History Museum Rotterdamlocation not on record	12
European Distributed Institute of Taxonomy (EDIT)location not on record	11
Sagamihara, JP	8
Ishikawa Museum of Natural Historylocation not on record	7
NSMKlocation not on record	4
KOMlocation not on record	4
Adam Mickiewicz University in Poznańlocation not on record	4
South Kensington, GB	3
Radicondoli, IT	3
Hiwa Museum of Natural Historylocation not on record	3
Kawasaki Shi Tama Ku, JP	3
ZSMlocation not on record	3
Philadelphia, US	3
HUNMlocation not on record	3
Salzburg, AT	2
University of Kaiserslauternlocation not on record	2
Iwate Prefectural Museumlocation not on record	2
Natural History Museum, Londonlocation not on record	2
Toyota city nature sanctuarylocation not on record	2
New Haven, US	2
KNAMlocation not on record	1
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	1
DABUHlocation not on record	1
JP	1
KIRMlocation not on record	1
Research Collection of Walter Ruckdeschellocation not on record	1
Chiba, JP	1
National Institute for Agro-Environmental Scienceslocation not on record	1
ZAF-UMUlocation not on record	1
CBDClocation not on record	1
Tallinn, EE	1
Brussels, BE	1
Rovaniemi, FI	1

41 institutions · 736 of 836 vouchered records shown · 100 without an institution code

09Environmental DNA89 detections

Where the DNA of Anania verbascalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found89

Studies independent surveys1

Countries19

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 89 detections have coordinates

Open the map19 countries0

wet forest/swampFloodplain forestfutaiedry grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 10.2–24.4

Seasonal swing summer↔winter19.8 °C

Max temp (day)22.0 °C 14.2–28.2

Min temp (night)13.1 °C 5.50–20.0

Precipitation79.7 mm/mo 27.7–192

Air humidity59.8 % 56.7–64.3

Moisture balance-14.1 mm/mo -110–70.1

Vapour deficit869 Pa 492–1,186

Wind speed2.80 m/s 1.60–4.20

Cloud cover35.4 % 31.4–43.0

CHELSA 1981–2010, ~9 km grid, at location & month of 63 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anania verbascalis

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type6 755 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 41 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 755 records