Anania labeculalis

Hulst, 1886 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Anania

At a glance

Occurrence records69

Data sources7

Biological traits0

DNA specimens9

eDNA detections4

Sources7 archives

Databases and archives Anania labeculalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility69 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF69 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD9 specimens

01Narrative

Anania labeculalis is a moth in the family Crambidae. It was described by George Duryea Hulst in 1886. It is found in North America, where it has been recorded from Arizona to western Texas. The wingspan is 17–20 mm. The forewings are ochreous yellow with a brownish tinge subterminally and at the costa. The hindwings are white at the base and light ochre outwardly.Hulst, G. D. 1886. Descriptions of new Pyralidae. Transactions of the American Entomological Society. (152)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anania labeculalis has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

TACTTTATATTTTATTTTTGGAATTTGAAGAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAGCCGAATTAGGTAATCCTGGCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anania verbascalissame genus5.9%Anania funebrissame genus6.8%Anania egentalissame genus7.0%Anania teneralissame genus7.8%Paranomis sidemialissame family7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type69 records

Wild obs. + sensor23

Museum / vouchered46

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 6≤1 km 3≤10 km 5

14 georeferenced · 9 without coordinates

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 7≤10 km 4

11 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence46

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	20
ASUlocation not on record	10
Cleveland Museum of Natural History, OH (CLEV)location not on record	6
Mississippi State, US	3
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	3
San Francisco, US	1
Georgia Museum of Natural Historylocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

8 institutions · 45 of 46 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Anania labeculalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.6 °C 21.6–23.1

Seasonal swing summer↔winter19.9 °C

Max temp (day)27.5 °C 27.5–29.1

Min temp (night)15.9 °C 15.9–17.5

Precipitation80.4 mm/mo 80.4–102

Air humidity50.9 % 50.9–53.2

Moisture balance-107 mm/mo -107–-70.8

Vapour deficit1,271 Pa 1,271–1,324

Wind speed3.20 m/s 2.20–3.20

Cloud cover23.3 % 20.2–23.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)