Anacampsis lacteusochrella

(Chambers, 1875) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Anacampsis

At a glance

Occurrence records53

Data sources8

Biological traits0

DNA specimens59

eDNA detections60

Sources8 archives

Databases and archives Anacampsis lacteusochrella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility53 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI60 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics59 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF53 records

Environmental DNA1 datasets · 1 countries60 detections

DNA & barcodingBOLD59 specimens

01Narrative

Anacampsis lacteusochrella is a moth of the family Gelechiidae. It was described by Vactor Tousey Chambers in 1875. It is found in North America, where it has been recorded from California.Moth Photographers Group at Mississippi State University Adults are creamy white or white very faintly suffused with ochreous, sparsely flecked with brown upon the forewings, which become towards the tip, suffused with greyish, or purplish brown and ochreous, so that a white costal streak at the beginning of the cilia may be distinguished from the surrounding part of the wing.Cincinnati Quarterly Journal of Science 2 (3): 244

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding59 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anacampsis lacteusochrella has left across the world's sequence archives.

At a glance

DNA specimens59

BINs1

Marker genes1

eDNA detections60

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus59 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

565Gmostly conserved

AACTTTATATTTCATTTTTGGTATTTGAGCTGGTATAATTGGAACATCCTTAAGTTTATTAATTCGAGCAGAATTAGGAAACCCCGGACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.04%

Haplotypes4

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anacampsis niveopulvellasame genus9.1%Anacampsis timidellasame genus9.3%Palpita annulatasame order9.4%Nolasena ferrifervenssame order9.7%Anacampsis blattariellasame genus9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type53 records

Wild obs. + sensor2

Museum / vouchered51

Range

Area of Occupancy AOO60 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 1≤1 km 12≤10 km 35>10 km 3

51 georeferenced

Open the institutions mapphysical evidence51

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	45
ASUlocation not on record	2
Essig Museumlocation not on record	2
New Haven, US	1
Essig Museum of Entomologylocation not on record	1

5 institutions · 51 of 51 vouchered records shown

09Environmental DNA60 detections

Where the DNA of Anacampsis lacteusochrella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found60

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 60 detections have coordinates

Open the map1 country0

Pines

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 7.70–17.6

Seasonal swing summer↔winter19.1 °C

Max temp (day)24.8 °C 13.5–25.0

Min temp (night)11.0 °C 3.00–11.4

Precipitation32.1 mm/mo 16.2–98.3

Air humidity48.5 % 48.5–57.7

Moisture balance-59.2 mm/mo -132–59.6

Vapour deficit1,031 Pa 461–1,031

Wind speed2.00 m/s 1.90–2.50

Cloud cover26.0 % 24.4–44.0

CHELSA 1981–2010, ~9 km grid, at location & month of 60 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)