Anacampsis fragariella

Busck, 1904 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Anacampsis

At a glance

Occurrence records57

Data sources8

Biological traits0

DNA specimens9

eDNA detections9

Sources8 archives

Databases and archives Anacampsis fragariella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility57 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF57 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD9 specimens

01Narrative

Anacampsis fragariella is a moth of the family Gelechiidae. It was described by August Busck in 1904. It is found in North America, where it has been recorded from Illinois, Indiana, Massachusetts, Michigan and Washington."Anacampsis Curtis, 1827" at Markku Savela's Lepidoptera and Some Other Life Forms. Retrieved July 6, 2017.Moth Photographers Group The wingspan is about 16 mm. The forewings are light whitish brown, the colour somewhat deeper toward the tip than at the base. There is a broad, ill-defined darker, mahogany-brown fascia at the apical third. The hindwings are dark fuscous. The larvae feed on Fragaria species.Proceedings of the United States National Museum 27 (1375): 760

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anacampsis fragariella has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.16%

Haplotypes1

BIN1

Where individuals differ — all 4 variable positions, in barcode order

202Cmostly conserved

238Amostly conserved

265Cmostly conserved

445Tmostly conserved

AACTTTATATTTTATTTTTGGTATCTGAGCAGGAATAGTTGGTACCTCATTAAGTTTACTAATTCGAGCAGAATTGGGAAATCCAGGACA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anacampsis timidellasame genus6.7%Anacampsis niveopulvellasame genus7.2%Anacampsis obscurellasame genus7.3%Anacampsis solemnellasame genus7.3%Anacampsis temerellasame genus7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type57 records

Wild obs. + sensor33

Museum / vouchered24

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 16≤1 km 7≤10 km 3>10 km 2

28 georeferenced · 5 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vernal, US	12
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
University of Alberta Museums (UAM)location not on record	3
Essig Museumlocation not on record	2
Colorado State Universitylocation not on record	1

5 institutions · 21 of 24 vouchered records shown · 3 without an institution code

09Environmental DNA9 detections

Where the DNA of Anacampsis fragariella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

1. Forest & Woodland | 1.4. Temperate ForestMixed HabitatGrassland4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 14.4–19.2

Seasonal swing summer↔winter25.1 °C

Max temp (day)24.5 °C 21.2–26.4

Min temp (night)10.2 °C 7.80–13.1

Precipitation66.3 mm/mo 42.8–99.8

Air humidity52.6 % 44.3–55.5

Moisture balance-74.7 mm/mo -87.9–-48.0

Vapour deficit1,016 Pa 787–1,141

Wind speed2.60 m/s 2.40–3.50

Cloud cover31.4 % 30.7–35.8

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)