Anabasis ochrodesma

Zeller, 1881 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Anabasis

At a glance

Occurrence records41

Data sources7

Biological traits0

DNA specimens144

eDNA detections143

Sources7 archives

Databases and archives Anabasis ochrodesma's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility41 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI143 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics144 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF41 records

Environmental DNA1 datasets · 2 countries143 detections

DNA & barcodingBOLD144 specimens

01Narrative

Anabasis ochrodesma, the cassia webworm, is a species of snout moth. It was described by Philipp Christoph Zeller in 1881. It is found from Florida through Puerto Rico, the Virgin Islands, Cuba, Grenada, Jamaica, Trinidad, Mexico, Guatemala and Panama to Colombia and Venezuela. Adults are on wing year round in several generations per year. The larvae feed on Cassia species, including Cassia obtusifolia, Cassia alata, Cassia bahamensis, Cassia fistula, Cassia javanica and Cassia siamea. Young larvae bore in the terminal shoots of the host plant. Later, they bind together several leaflets with silk to form a flat shelter. They feed on the inner epidermis and mesophyll of these leaflets from within their shelter. Several larvae may be found in a single shelter.Systematics of immature phycitines (Lepidoptera: Pyralidae)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding144 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anabasis ochrodesma has left across the world's sequence archives.

At a glance

DNA specimens144

BINs1

Marker genes1

eDNA detections143

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus139 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

88Cvariable

118Tmostly conserved

403Amostly conserved

433Amostly conserved

634Tvariable

AACTTTATATTTTATTTTTGGAATTTGATCAGGTATAGTTGGAACATCTTTAAGTCTTTTAATTCGAGCAGAACTTGGAACCCCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.29%

Haplotypes15

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Copamyntis obliquifasciellasame family5.2%Acrobasis obtusellasame family6.1%Acrobasis bithynellasame family6.9%Acrobasis obliquasame family7.3%Interjectio columbiellasame family7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type41 records

Wild obs. + sensor9

Museum / vouchered32

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 3≤1 km 1≤10 km 3

7 georeferenced · 2 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	19
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	7
Georgia Museum of Natural Historylocation not on record	3
University of Pennsylvanialocation not on record	1
Research Collection of D. H. Janzen & W. Hallwachslocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

6 institutions · 32 of 32 vouchered records shown

09Environmental DNA143 detections

Where the DNA of Anabasis ochrodesma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found143

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 143 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…Other

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 23.0–26.2

Seasonal swing summer↔winter2.40 °C

Max temp (day)26.9 °C 26.0–29.6

Min temp (night)21.1 °C 20.0–24.0

Precipitation92.9 mm/mo 21.2–325

Air humidity65.6 % 60.1–70.5

Moisture balance-44.1 mm/mo -133–167

Vapour deficit999 Pa 865–1,304

Wind speed3.50 m/s 1.60–6.30

Cloud cover18.9 % 15.1–38.6

CHELSA 1981–2010, ~9 km grid, at location & month of 141 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)