Amphipoea lucens

Freyer, 1845 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Amphipoea

At a glance

Occurrence records14 217

Data sources9

Biological traits0

DNA specimens53

eDNA detections2

Sources9 archives

Databases and archives Amphipoea lucens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 217 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics53 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF14 217 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD53 specimens

Genome at a glanceGoaT · NCBI≈648 Mbp

01Narrative

Amphipoea lucens, the large ear or large ear moth, is a moth of the family Noctuidae. It was first described by Christian Friedrich Freyer in 1845 and it is found in most of Europe. the wingspan is about 30–36 mm. It resembles Amphipoea oculea, but is larger, and with the ground colour, as a rule, pale and the reniform white. Adults are on wing from August to September. The larvae feed on the roots and stem bases of various grasses, especially Molinia caerulea.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding53 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphipoea lucens has left across the world's sequence archives.

At a glance

DNA specimens53

BINs2

Marker genes2

eDNA detections2

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus44 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

37Amostly conserved

118Tmostly conserved

142Tmostly conserved

145Tmostly conserved

193Cmostly conserved

199Cvariable

250Tmostly conserved

256Tmostly conserved

263Tmostly conserved

265Gvariable

304Cmostly conserved

340Tmostly conserved

400Tmostly conserved

418Tmostly conserved

448Cmostly conserved

478Tmostly conserved

517Gvariable

539Cmostly conserved

548Tmostly conserved

562Amostly conserved

634Tmostly conserved

646Tmostly conserved

652Tmostly conserved

653Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACCTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes13

BINs2

Most divergent pair4.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amphipoea crinanensissame genus2.0%Amphipoea asiaticasame genus2.6%Amphipoea americanasame genus2.7%Gortyna hethiticasame family3.2%Amphipoea interoceanicasame genus3.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PEF1-alpha

animal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Amphipoea lucens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈647 703 034 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Amphipoea lucens0.65 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.7% BUSCO

08Occurrence & distribution

Record type14 217 records

Wild obs. + sensor12 461

Museum / vouchered1 713

Other43

Origin

Native81

Range

Area of Occupancy AOO10 936 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy36% within 1 km

≤100 m 2 859≤1 km 1 577≤10 km 7 796>10 km 37

12 269 georeferenced · 192 without coordinates

Open the mapobservation + sensor12 461

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 400≤1 km 540≤10 km 598>10 km 29

1 567 georeferenced · 146 without coordinates

Open the institutions mapphysical evidence1 713

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	531
DanishLepidopterologicalSocietylocation not on record	364
Provincia di Livornolocation not on record	131
Tartu, EE	120
Salzburg, AT	84
NHMOlocation not on record	37
Kuopio, FI	27
NTNU-VMlocation not on record	19
SLU Artdatabankenlocation not on record	15
DABUHlocation not on record	15
Zürich, CH	12
MZLUlocation not on record	11
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	10
Tallinn, EE	10
Nijmegen, NL	8
ZMAAlocation not on record	7
Bern, CH	7
South Kensington, GB	6
Natural History Museum, Londonlocation not on record	5
Philadelphia, US	5
Natural History Museum Rotterdamlocation not on record	5
neflocation not on record	4
ZSMlocation not on record	3
Uniwersytet Łódzkilocation not on record	3
Fribourg, CH	3
Universität Zürich, Naturhistorisches Museumlocation not on record	2
Archäologie und Museum Baselland - Museum.BLlocation not on record	2
Frauenfeld, CH	2
Sion, CH	2
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	2
Musee d'Histoire Naturallelocation not on record	2
Tromsø, NO	2
Metsähallituslocation not on record	2
NMBU:MINAlocation not on record	2
Muzeum Górnośląskie w Bytomiulocation not on record	1
Toronto, CA	1
Stockholm, SE	1
Podgorica, ME	1
Research Collection of G. Orhantlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
KIRMlocation not on record	1
NCMGlocation not on record	1

42 institutions · 1 468 of 1 713 vouchered records shown · 245 without an institution code

09Environmental DNA2 detections

Where the DNA of Amphipoea lucens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 15.1–18.0

Seasonal swing summer↔winter18.7 °C

Max temp (day)20.6 °C 19.0–22.2

Min temp (night)12.2 °C 11.1–13.3

Precipitation144 mm/mo 126–162

Air humidity62.6 % 61.8–63.4

Moisture balance49.5 mm/mo 42.9–56.0

Vapour deficit708 Pa 658–757

Wind speed2.60 m/s 2.30–3.00

Cloud cover38.9 % 36.5–41.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amphipoea lucens

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type14 217 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 42 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type14 217 records