Amphipoea americana

Speyer, 1875 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Amphipoea

At a glance

Occurrence records1 496

Data sources7

Biological traits0

DNA specimens64

eDNA detections62

Sources7 archives

Databases and archives Amphipoea americana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 496 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI62 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics64 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 496 records

Environmental DNA1 datasets · 2 countries62 detections

DNA & barcodingBOLD64 specimens

01Narrative

Amphipoea americana, the American ear moth, is a moth of the family Noctuidae. The species was first described by Adolph Speyer in 1875. It is found from coast to coast in the northern United States and southern Canada, it is also present in the Northwest Territories, south in the west to California, south in the east to Georgia The wingspan is 28–35 mm. Adults are on wing from July to September depending on the location. The larvae feed on grasses, sedges and sometimes on the roots of corn.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding64 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphipoea americana has left across the world's sequence archives.

At a glance

DNA specimens64

BINs1

Marker genes1

eDNA detections62

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus62 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

415Gmostly conserved

628Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACCTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.11%

Haplotypes7

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amphipoea fucosasame genus2.3%Amphipoea crinanensissame genus2.6%Amphipoea lucenssame genus2.7%Amphipoea interoceanicasame genus3.0%Amphipoea asiaticasame genus3.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 496 records

Wild obs. + sensor552

Museum / vouchered944

Range

Area of Occupancy AOO2 380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 326≤1 km 65≤10 km 27>10 km 37

455 georeferenced · 97 without coordinates

Open the mapobservation + sensor552

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 34≤1 km 90≤10 km 348>10 km 16

488 georeferenced · 456 without coordinates

Open the institutions mapphysical evidence944

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	260
University of Alberta Museums (UAM)location not on record	180
East Lansing, US	164
St. Paul, US	75
Cleveland Museum of Natural History, OH (CLEV)location not on record	49
Royal Saskatchewan Museumlocation not on record	34
UNHClocation not on record	19
North Carolina State University Insect Museumlocation not on record	16
University of Guelph, Centre for Biodiversity Genomicslocation not on record	16
Mississippi State, US	11
München, DE	9
Washington, US	8
Vernal, US	7
Denver, US	6
University of Guelphlocation not on record	6
Edmonton, CA	6
SOVTlocation not on record	5
Oregon State Arthropod Collectionlocation not on record	5
Biodiversity Institute of Ontariolocation not on record	5
Albuquerque, US	5
OSUClocation not on record	4
UDlocation not on record	4
Toronto, CA	4
Essig Museum of Entomologylocation not on record	3
Cambridge, US	2
Saint John, CA	2
Colorado State Universitylocation not on record	1
Georgia Museum of Natural Historylocation not on record	1
ASUlocation not on record	1
University Park, US	1
KWPlocation not on record	1

31 institutions · 910 of 944 vouchered records shown · 34 without an institution code

09Environmental DNA62 detections

Where the DNA of Amphipoea americana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found62

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 62 detections have coordinates

Open the map2 countries0

AgriculturalPrairie habitatAgricultural field14. Artificial - Terrestrial|14.1 Arable LandRiparian ZoneTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 15.5–20.4

Seasonal swing summer↔winter26.1 °C

Max temp (day)23.2 °C 21.5–25.7

Min temp (night)14.7 °C 11.4–16.0

Precipitation95.1 mm/mo 59.4–137

Air humidity59.1 % 57.0–64.5

Moisture balance-40.9 mm/mo -59.1–16.3

Vapour deficit816 Pa 705–1,019

Wind speed3.20 m/s 2.20–3.50

Cloud cover40.5 % 28.8–46.5

CHELSA 1981–2010, ~9 km grid, at location & month of 59 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amphipoea americana

At a glance

Sources7 archives

At a glance

Record type1 496 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 496 records