Amphipoea crinanensis

Burrows, 1908 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Amphipoea

At a glance

Occurrence records4 423

Data sources7

Biological traits2

DNA specimens56

eDNA detections36

Sources7 archives

Databases and archives Amphipoea crinanensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 423 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics56 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF4 423 records

Environmental DNA1 datasets · 3 countries36 detections

DNA & barcodingBOLD56 specimens

01Narrative

Amphipoea crinanensis, the Crinan ear, is a moth of the family Noctuidae. The species was first described by Charles Richard Nelson Burrows in 1908. It is found in Fennoscandia, Ireland, Great Britain, Denmark, Germany, the Baltic region and central Russia. The wingspan is 30–33 mm. The ground colour of the forewings ranges from burnt sienna through to reddish brown. The colour ranges from burnt sienna through to reddish brown. The reniform stigma is yellow or orange or occasionally white. The orbicular stigma obscure. The crosslines are darker than the ground colour. The hindwings are brownish ochreous and have a small discal spot. Adults are on wing from August to September. The larvae are thought to feed inside the stems of Iris pseudacorus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding56 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphipoea crinanensis has left across the world's sequence archives.

At a glance

DNA specimens56

BINs3

Marker genes14

eDNA detections36

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus40 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

85Cvariable

118Tmostly conserved

139Tvariable

220Tmostly conserved

263Tvariable

265Avariable

268Cvariable

304Tmostly conserved

340Tvariable

355Cmostly conserved

364Tmostly conserved

394Cmostly conserved

400Cmostly conserved

403Cvariable

407Tvariable

427Tvariable

478Cmostly conserved

514Tvariable

517Amostly conserved

542Tvariable

562Gmostly conserved

601Cmostly conserved

616Tvariable

628Avariable

641Tvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACCTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes5

BINs3

Most divergent pair3.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amphipoea fucosasame genus1.5%Amphipoea interoceanicasame genus1.8%Amphipoea lucenssame genus2.0%Amphipoea americanasame genus2.6%Amphipoea senilissame genus2.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16Satp6ATP8COIICOXIIICYTBND1ND2ND3ND4ND4LND6MT-NADH5

animal barcoderibosomalmitochondrialmarker

08Occurrence & distribution

Record type4 423 records

Wild obs. + sensor3 409

Museum / vouchered1 014

Range

Area of Occupancy AOO4 080 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy35% within 1 km

≤100 m 627≤1 km 514≤10 km 2 078>10 km 21

3 240 georeferenced · 169 without coordinates

Open the mapobservation + sensor3 409

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 263≤1 km 200≤10 km 449>10 km 60

972 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence1 014

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	377
DanishLepidopterologicalSocietylocation not on record	280
Tartu, EE	84
NHMOlocation not on record	50
RMZlocation not on record	34
Kuopio, FI	28
NTNU-VMlocation not on record	26
SLU Artdatabankenlocation not on record	16
ZMAAlocation not on record	14
DABUHlocation not on record	10
MZLUlocation not on record	9
University of Tokyo, Department of Zoologylocation not on record	7
Tallinn, EE	6
Provincia di Livornolocation not on record	3
South Kensington, GB	3
neflocation not on record	3
Natural History Museum, Londonlocation not on record	2
NMBU:MINAlocation not on record	1
BioFokuslocation not on record	1

19 institutions · 954 of 1 014 vouchered records shown · 60 without an institution code

09Environmental DNA36 detections

Where the DNA of Amphipoea crinanensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 4.50–16.2

Seasonal swing summer↔winter14.6 °C

Max temp (day)16.4 °C 7.30–18.1

Min temp (night)11.5 °C 1.50–13.5

Precipitation125 mm/mo 58.4–159

Air humidity64.2 % 62.1–65.8

Moisture balance30.3 mm/mo 0–98.6

Vapour deficit559 Pa 375–698

Wind speed4.10 m/s 2.30–5.00

Cloud cover47.3 % 38.8–54.6

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amphipoea crinanensis

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type4 423 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 423 records