Amphipoea interoceanica

Smith, 1899 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Amphipoea

At a glance

Occurrence records120

Data sources7

Biological traits0

DNA specimens36

eDNA detections36

Sources7 archives

Databases and archives Amphipoea interoceanica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility120 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF120 records

Environmental DNA1 datasets · 3 countries36 detections

DNA & barcodingBOLD36 specimens

01Narrative

Amphipoea interoceanica, the interoceanic ear moth, strawberry cutworm moth or strawberry cutworm, is a moth of the family Noctuidae first described by Smith in 1899. It is found from coast to coast in the United States. In Canada from Quebec west to Alberta (but not the coastal provinces), Nova Scotia. The wingspan is 28–35 mm. Adults are on wing from July to August depending on the location. The larvae feed on the leaves, stems and fruit stalks of Fragaria species, grasses and sedges.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphipoea interoceanica has left across the world's sequence archives.

At a glance

DNA specimens36

BINs1

Marker genes1

eDNA detections36

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

160Amostly conserved

433Amostly conserved

550Amostly conserved

562Gmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACCTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.23%

Haplotypes7

BIN1

Most divergent pair1.2%

N.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amphipoea asiaticasame genus1.8%Amphipoea crinanensissame genus1.8%Amphipoea senilissame genus2.4%Amphipoea keiferisame genus2.7%Amphipoea fucosasame genus2.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type120 records

Wild obs. + sensor9

Museum / vouchered111

Range

Area of Occupancy AOO292 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 1

4 georeferenced · 5 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤1 km 15≤10 km 18>10 km 2

35 georeferenced · 76 without coordinates

Open the institutions mapphysical evidence111

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	37
East Lansing, US	22
Washington, US	12
Cleveland Museum of Natural History, OH (CLEV)location not on record	7
Cambridge, US	6
New Haven, US	5
Royal Saskatchewan Museumlocation not on record	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Decorah, US	1
Biodiversity Institute of Ontariolocation not on record	1
Cornell University Insect Collectionlocation not on record	1
SOVTlocation not on record	1

12 institutions · 101 of 111 vouchered records shown · 10 without an institution code

09Environmental DNA36 detections

Where the DNA of Amphipoea interoceanica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map3 countries0

Grassland4. Native GrasslandPrairie habitatRiparian Zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 15.6–23.6

Seasonal swing summer↔winter19.4 °C

Max temp (day)18.9 °C 16.4–28.7

Min temp (night)17.5 °C 12.8–19.2

Precipitation107 mm/mo 31.9–129

Air humidity64.8 % 57.3–70.6

Moisture balance94.1 mm/mo

Vapour deficit613 Pa 448–1,209

Wind speed4.90 m/s

Cloud cover38.9 % 29.0–44.5

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)