Ammophila kennedyi

(Murray, 1938) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Sphecidae/Ammophila

At a glance

Occurrence records398

Data sources7

Biological traits0

DNA specimens13

eDNA detections17

Sources7 archives

Databases and archives Ammophila kennedyi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility398 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF398 records

Environmental DNA1 datasets · 2 countries17 detections

DNA & barcodingBOLD13 specimens

01Narrative

Ammophila kennedyi es una especie de avispa del género Ammophila, familia Sphecidae.Ammophila TSN 154323 Sistema Integrado de Información Taxonómica. Consultado el 29 de abril de 2021. Fue descrito por primera vez en 1938 por Murray.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ammophila kennedyi has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes1

eDNA detections17

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

26Avariable

38Cvariable

47Tvariable

62Cvariable

77Avariable

80Tvariable

113Tvariable

161Cvariable

320Avariable

341Avariable

356Cvariable

392Cvariable

398Tvariable

413Gvariable

456Avariable

476Tvariable

482Tvariable

530Cvariable

578Avariable

579Cvariable

623Amostly conserved

626Avariable

TATTATACTTTATTTTCAGAATATGATCAGGATTATACGGAGCATCTTTAAGAATAATCATCCGAATAGAATTAGGAACTCCAGGAAAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes3

BINs2

Most divergent pair3.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ammophila aztecasame genus10.6%Ammophila mediatasame genus11.5%Ammophila abertisame genus11.6%Ammophila picipessame genus12.7%Ammophila strenuasame genus12.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type398 records

Wild obs. + sensor2

Museum / vouchered396

Range

Area of Occupancy AOO524 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤1 km 11≤10 km 127>10 km 11

149 georeferenced · 247 without coordinates

Open the institutions mapphysical evidence396

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	103
US	90
University of Guelphlocation not on record	69
Royal Saskatchewan Museumlocation not on record	50
Universidad Católica de Manizaleslocation not on record	43
OSUClocation not on record	9
WIlocation not on record	8
San Francisco, US	7
University of Central Floridalocation not on record	6
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Sydney, AU	2
California State Collection of Arthropodslocation not on record	2
New Haven, US	1
San Diego, US	1
Colorado State Universitylocation not on record	1

15 institutions · 394 of 396 vouchered records shown · 2 without an institution code

09Environmental DNA17 detections

Where the DNA of Ammophila kennedyi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map2 countries0

1. Forest & Woodland | 1.4. Temperate Forest4. Grassland | 4.4. Grassland - Temperate4. Native Grassland | 4.4. Temperate GrasslandGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 13.2–19.8

Seasonal swing summer↔winter25.5 °C

Max temp (day)25.7 °C 20.2–27.0

Min temp (night)10.0 °C 5.90–14.0

Precipitation43.4 mm/mo 33.4–80.7

Air humidity51.3 % 45.0–52.4

Moisture balance-122 mm/mo -123–-54.3

Vapour deficit1,114 Pa 747–1,161

Wind speed2.80 m/s 2.30–3.90

Cloud cover35.2 % 29.5–39.8

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)