Ammophila aberti

Haldeman, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Sphecidae/Ammophila

At a glance

Occurrence records434

Data sources7

Biological traits0

DNA specimens20

eDNA detections34

Sources7 archives

Databases and archives Ammophila aberti's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility434 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF434 records

Environmental DNA1 datasets · 2 countries34 detections

DNA & barcodingBOLD20 specimens

01Narrative

Ammophila aberti is a species of thread-waisted wasp in the family Sphecidae. It is found in North América,Discover Life

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ammophila aberti has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

eDNA detections34

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 28 variable positions, in barcode order

13Tmostly conserved

37Amostly conserved

217Amostly conserved

235Cmostly conserved

250Cvariable

266Cmostly conserved

319Amostly conserved

322Avariable

331Amostly conserved

334Tmostly conserved

340Cmostly conserved

395Cmostly conserved

400Tvariable

436Amostly conserved

445Cmostly conserved

448Tmostly conserved

454Cvariable

542Tvariable

556Tmostly conserved

559Amostly conserved

568Tmostly conserved

581Tmostly conserved

589Cmostly conserved

637Cvariable

640Tmostly conserved

641Cvariable

643Amostly conserved

646Cvariable

AATACTTTATTTTATCTTTAGAATATGATCAGGATTATACGGAGCATCTTTAAGAATAATTATTCGAATAGAACTAGGAACTCCTGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes5

BIN1

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ammophila aztecasame genus9.9%Ammophila heydenisame genus10.6%Ammophila picipessame genus10.8%Ammophila kennedyisame genus11.6%Podalonia affinissame family11.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type434 records

Wild obs. + sensor207

Museum / vouchered227

Range

Area of Occupancy AOO1 136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 101≤1 km 35≤10 km 11>10 km 15

162 georeferenced · 45 without coordinates

Open the mapobservation + sensor207

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy4% within 1 km

≤1 km 8≤10 km 161>10 km 38

207 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence227

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	111
San Diego, US	44
Universidad Católica de Manizaleslocation not on record	33
New Haven, US	7
US	6
College Station, US	4
Sydney, AU	4
EL PASO, US	3
Albuquerque, US	3
California State Collection of Arthropodslocation not on record	3
Colorado State Universitylocation not on record	2
Royal Saskatchewan Museumlocation not on record	2
WIlocation not on record	1
San Francisco, US	1
University of Central Floridalocation not on record	1
Chicago, US	1
California Department for Food and Agriculturelocation not on record	1

17 institutions · 227 of 227 vouchered records shown

09Environmental DNA34 detections

Where the DNA of Ammophila aberti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map2 countries0

AridPurshia tridentata, Artemesia tridentata, sandLakeshore, sand, benches, Purshia, Chrysotha…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.6 °C 22.9–31.7

Seasonal swing summer↔winter22.9 °C

Max temp (day)35.1 °C 29.2–37.6

Min temp (night)20.4 °C 15.6–24.2

Precipitation4.10 mm/mo 1.30–62.7

Air humidity35.0 % 32.9–50.2

Moisture balance-201 mm/mo -208–-115

Vapour deficit2,621 Pa 1,456–3,029

Wind speed3.00 m/s 2.30–3.20

Cloud cover19.4 % 13.6–31.9

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)