Ammophila azteca

Cameron, 1888 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Sphecidae/Ammophila

At a glance

Occurrence records442

Data sources7

Biological traits0

DNA specimens33

eDNA detections62

Sources7 archives

Databases and archives Ammophila azteca's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility442 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI62 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF442 records

Environmental DNA1 datasets · 3 countries62 detections

DNA & barcodingBOLD33 specimens

01Narrative

Ammophila azteca is a species of thread-waisted wasp in the family Sphecidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ammophila azteca has left across the world's sequence archives.

At a glance

DNA specimens33

BINs6

Marker genes1

eDNA detections62

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 71 variable positions, in barcode order

4Avariable

7Tmostly conserved

19Tmostly conserved

23Amostly conserved

31Amostly conserved

43Tmostly conserved

50Tmostly conserved

52Avariable

58Amostly conserved

64Cmostly conserved

77Gmostly conserved

85Tmostly conserved

106Tvariable

121Tvariable

127Tmostly conserved

136Tvariable

157Tvariable

169Tmostly conserved

181Gvariable

184Amostly conserved

197Tvariable

200Amostly conserved

202Tmostly conserved

205Tvariable

212Tmostly conserved

214Amostly conserved

223Amostly conserved

229Avariable

232Cmostly conserved

250Tvariable

271Tvariable

325Amostly conserved

337Avariable

340Tmostly conserved

343Tmostly conserved

346Tvariable

359Cvariable

364Cvariable

373Amostly conserved

382Avariable

385Cmostly conserved

407Tmostly conserved

412Tvariable

417Tmostly conserved

424Tvariable

436Tmostly conserved

442Cmostly conserved

448Tmostly conserved

451Cmostly conserved

454Tmostly conserved

458Tvariable

484Amostly conserved

500Cmostly conserved

529Tmostly conserved

532Cmostly conserved

533Cmostly conserved

535Tmostly conserved

547Tvariable

548Cmostly conserved

553Tmostly conserved

568Amostly conserved

586Cmostly conserved

595Cmostly conserved

596Tmostly conserved

598Amostly conserved

601Tmostly conserved

610Cmostly conserved

619Tmostly conserved

622Amostly conserved

628Avariable

653Cvariable

AATACTTTATTTTATTTTTAGAATATGATCAGGATTATATGGTGCATCATTAAGAATAATTATCCGAATAGAATTAGGAACTCCTGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.5%

Haplotypes12

BINs6

Most divergent pair12.6%

N.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ammophila mediatasame genus9.7%Ammophila abertisame genus9.9%Ammophila kennedyisame genus10.6%Podalonia mexicanasame family10.6%Ammophila sabulosasame genus11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type442 records

Wild obs. + sensor16

Museum / vouchered426

Range

Area of Occupancy AOO796 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 11≤1 km 1≤10 km 2

14 georeferenced · 2 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 5≤1 km 18≤10 km 160>10 km 41

224 georeferenced · 202 without coordinates

Open the institutions mapphysical evidence426

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidad Católica de Manizaleslocation not on record	66
San Diego, US	53
WIlocation not on record	52
San Francisco, US	51
US	40
University of Guelphlocation not on record	40
Santa Barbara Museum of Natural Historylocation not on record	26
Royal Saskatchewan Museumlocation not on record	21
ASUlocation not on record	19
University of Guelph, Centre for Biodiversity Genomicslocation not on record	11
Edmonton, CA	11
Toronto, CA	11
New Haven, US	6
Colorado State Universitylocation not on record	5
University of Central Floridalocation not on record	4
EL PASO, US	3
Anchorage, US	1
California State Collection of Arthropodslocation not on record	1

18 institutions · 421 of 426 vouchered records shown · 5 without an institution code

09Environmental DNA62 detections

Where the DNA of Ammophila azteca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found62

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 62 detections have coordinates

Open the map3 countries0

1. Forest & Woodland|1.4. Temperate ForestForestMixed Habitat4. Native GrasslandWetlandGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 13.3–24.1

Seasonal swing summer↔winter22.9 °C

Max temp (day)23.2 °C 18.8–30.8

Min temp (night)12.2 °C 6.20–17.4

Precipitation23.0 mm/mo 6.90–74.2

Air humidity51.2 % 39.2–57.9

Moisture balance-101 mm/mo -162–-46.3

Vapour deficit978 Pa 682–1,755

Wind speed2.60 m/s 1.80–4.50

Cloud cover31.4 % 12.2–41.9

CHELSA 1981–2010, ~9 km grid, at location & month of 59 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)