Ammophila mediata

Cresson, 1865 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Sphecidae/Ammophila

At a glance

Occurrence records118

Data sources7

Biological traits0

DNA specimens17

eDNA detections13

Sources7 archives

Databases and archives Ammophila mediata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility118 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF118 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingBOLD17 specimens

01Narrative

Ammophila mediata es una especie de avispa del género Ammophila, familia Sphecidae.Ammophila TSN 154323 Sistema Integrado de Información Taxonómica. Consultado el 29 de abril de 2021. Fue descrito por primera vez en 1865 por Cresson.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ammophila mediata has left across the world's sequence archives.

At a glance

DNA specimens17

BINs2

Marker genes1

eDNA detections13

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

49Cmostly conserved

82Gvariable

125Amostly conserved

133Tmostly conserved

271Tmostly conserved

304Cmostly conserved

310Cvariable

328Amostly conserved

337Tmostly conserved

364Cmostly conserved

370Cmostly conserved

388Gmostly conserved

457Tmostly conserved

517Tmostly conserved

581Cvariable

616Tmostly conserved

628Gmostly conserved

641Tmostly conserved

AATATTATATTTTATTTTCAGAATTTGATCAGGATTATATGGAGCATCCTTAAGAATAATTATTCGAATAGAATTAGGTACGCCTGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.83%

Haplotypes5

BINs2

Most divergent pair2.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ammophila aztecasame genus9.7%Ammophila strenuasame genus10.2%Ammophila evansisame genus10.6%Ammophila sabulosasame genus10.8%Podalonia minaxsame family11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type118 records

Wild obs. + sensor5

Museum / vouchered113

Range

Area of Occupancy AOO212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 1

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 4≤1 km 4≤10 km 8>10 km 1

17 georeferenced · 96 without coordinates

Open the institutions mapphysical evidence113

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	68
Toronto, CA	10
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
Edmonton, CA	5
Royal Saskatchewan Museumlocation not on record	5
New Haven, US	4
WIlocation not on record	3
US	2
Universidad Católica de Manizaleslocation not on record	2
ASUlocation not on record	2
San Francisco, US	1

11 institutions · 107 of 113 vouchered records shown · 6 without an institution code

09Environmental DNA13 detections

Where the DNA of Ammophila mediata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

Forest1. Forest & Woodland | 1.1. Boreal ForestRiparian Zone4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 10.3–16.9

Seasonal swing summer↔winter25.9 °C

Max temp (day)19.2 °C 16.2–23.2

Min temp (night)9.20 °C 4.50–13.4

Precipitation70.4 mm/mo 52.8–103

Air humidity54.6 % 49.6–57.2

Moisture balance-51.0 mm/mo -104–-7.70

Vapour deficit743 Pa 569–904

Wind speed2.60 m/s 1.70–3.10

Cloud cover40.0 % 32.6–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)