Amegilla quadrifasciata

(de Villers, 1789) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Amegilla

At a glance

Occurrence records3 832

Data sources7

Biological traits2

DNA specimens39

eDNA detections2

Sources7 archives

Databases and archives Amegilla quadrifasciata's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 832 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 832 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD39 specimens

01Narrative

Amegilla quadrifasciata, the white-banded digger bee, is a species of bee belonging to the family Apidae subfamily Apinae.BiolibCatalogue of lifeHymenoptera on line

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology2

Body length1.25 cm

Intertegular distance (ITD)3.8 mm

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amegilla quadrifasciata has left across the world's sequence archives.

At a glance

DNA specimens39

BINs1

Marker genes1

eDNA detections2

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

37Gmostly conserved

90Cmostly conserved

190Tmostly conserved

217Tmostly conserved

241Tmostly conserved

286Gmostly conserved

287Amostly conserved

302Amostly conserved

310Amostly conserved

315Gmostly conserved

317Tmostly conserved

355Amostly conserved

568Gmostly conserved

TATAATTTATTTTTTATTTGCTATATGATCAGGTATGATTGGTTCAGCAATAAGAATAATTATTCGTATAGAATTAAGTACACCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes6

BIN1

Most divergent pair1.7%

EuropeOtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophora femoratasame family12.3%Anthophora abruptasame family12.6%Anthophora quadrimaculatasame family12.8%Anthophora disparsame family13.6%Anthophora mucidasame family13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 832 records

Wild obs. + sensor2 641

Museum / vouchered747

Other444

Origin

Native75

Range

Area of Occupancy AOO7 188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 1 326≤1 km 304≤10 km 116>10 km 62

1 808 georeferenced · 833 without coordinates

Open the mapobservation + sensor2 641

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 12≤1 km 150≤10 km 276>10 km 14

452 georeferenced · 295 without coordinates

Open the institutions mapphysical evidence747

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	249
Beltsville, US	108
Helsinki, FI	75
Coimbra, PT	66
Philadelphia, US	41
Wuzhou, CN	37
IMEDEAlocation not on record	31
	30
Cambridge, US	20
Bando, JP	14
Sam Noble Oklahoma Museum of Natural Historylocation not on record	14
UMONSlocation not on record	5
Museu Nacional de História Natural e da Ciêncialocation not on record	4
Museo Nacional de Ciencias Naturaleslocation not on record	3
Paro, BT	2
US	2
USALlocation not on record	2
Toyama, JP	2
Muzeum Górnośląskie w Bytomiulocation not on record	2
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	2
UGRlocation not on record	2
Provincia di Livornolocation not on record	1
OSUClocation not on record	1
Atlantic Reference Centrelocation not on record	1
Bern, CH	1

25 institutions · 715 of 747 vouchered records shown · 31 without an institution code

09Environmental DNA2 detections

Where the DNA of Amegilla quadrifasciata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.5 °C 18.5–18.5

Seasonal swing summer↔winter6.10 °C

Max temp (day)19.5 °C

Min temp (night)17.6 °C

Precipitation92.9 mm/mo

Air humidity60.1 %

Vapour deficit854 Pa

Cloud cover38.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amegilla quadrifasciata

At a glance

Sources7 archives

Size & morphology2

At a glance

Record type3 832 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 832 records