Amegilla niveata

(Friese, 1905) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Amegilla

At a glance

Occurrence records800

Data sources7

Biological traits0

DNA specimens11

eDNA detections3

Sources7 archives

Databases and archives Amegilla niveata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility800 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF800 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD11 specimens

01Narrative

Amegilla niveata es una especie de abeja del género Amegilla, familia Apidae.Amegilla TSN 634005 Sistema Integrado de Información Taxonómica. Consultado el 2 de mayo de 2021.Amegilla Catalogue of Life. Consultado el 2 de mayo de 2021. Fue descrita científicamente por Friese en 1905.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amegilla niveata has left across the world's sequence archives.

At a glance

DNA specimens11

BINs3

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Diversity (π)4.3%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 106 variable positions, in barcode order

58Amostly conserved

67Tmostly conserved

70Gmostly conserved

74Cmostly conserved

76Tmostly conserved

79Tmostly conserved

80Gmostly conserved

81Tmostly conserved

82Tmostly conserved

85Gmostly conserved

88Tmostly conserved

90Cmostly conserved

91Tmostly conserved

97Cmostly conserved

99Gmostly conserved

100Tmostly conserved

110Gmostly conserved

112Gmostly conserved

119Amostly conserved

122Amostly conserved

124Gmostly conserved

127Tmostly conserved

131Amostly conserved

132Tmostly conserved

148Gmostly conserved

160Gmostly conserved

181Tmostly conserved

196Gmostly conserved

199Gmostly conserved

205Amostly conserved

212Tmostly conserved

217Tmostly conserved

219Cmostly conserved

223Tmostly conserved

235Tmostly conserved

251Gmostly conserved

256Gmostly conserved

271Amostly conserved

281Amostly conserved

286Gmostly conserved

289Gmostly conserved

295Gmostly conserved

298Tmostly conserved

302Tmostly conserved

308Cmostly conserved

310Amostly conserved

311Gmostly conserved

315Gmostly conserved

319Tmostly conserved

328Tmostly conserved

334Tmostly conserved

352Tmostly conserved

354Cmostly conserved

355Tmostly conserved

357Amostly conserved

359Cmostly conserved

361Tmostly conserved

363Amostly conserved

368Tmostly conserved

369Cmostly conserved

382Tmostly conserved

391Tmostly conserved

407Tmostly conserved

415Gmostly conserved

421Tmostly conserved

424Tmostly conserved

428Gmostly conserved

429Cmostly conserved

430Tmostly conserved

436Tmostly conserved

451Tmostly conserved

455Gmostly conserved

460Gmostly conserved

463Gmostly conserved

473Tmostly conserved

475Gmostly conserved

478Tmostly conserved

481Amostly conserved

493Gmostly conserved

497Cmostly conserved

498Cmostly conserved

511Gmostly conserved

526Tmostly conserved

529Tmostly conserved

530Tmostly conserved

532Gmostly conserved

535Gmostly conserved

542Cmostly conserved

544Tmostly conserved

556Amostly conserved

562Tmostly conserved

565Tmostly conserved

568Tmostly conserved

574Amostly conserved

578Cmostly conserved

580Tmostly conserved

581Gmostly conserved

583Amostly conserved

592Tmostly conserved

604Tmostly conserved

615Amostly conserved

625Gmostly conserved

628Tmostly conserved

643Gmostly conserved

649Gmostly conserved

655Gmostly conserved

TATAATTTACTTCTTATTTGCTATGTGGTCTGGTATGATTGGTAGGGCAATGAGTATAATTATTCGTATGGAACTTAGTGTTCCGGGTGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amegilla quadrifasciatasame genus14.4%Anthophora femoratasame family15.0%Anthophora atroalbasame family15.2%Anthophora abruptasame family15.2%Anthophora quadrimaculatasame family15.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type800 records

Wild obs. + sensor20

Museum / vouchered780

Range

Area of Occupancy AOO1 460 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 15≤1 km 1≤10 km 3

19 georeferenced · 1 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 3>10 km 1

4 georeferenced · 776 without coordinates

Open the institutions mapphysical evidence780

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	216
Cape Town, ZA	150
Beltsville, US	133
	105
ARC-Plant Protection Research Institute, National Collection of Fungi: Culture Collectionlocation not on record	89
Atlantic Reference Centrelocation not on record	80
Wuzhou, CN	3
Cambridge, US	2
Bonn, DE	1
Agricultural Research Council, South Africalocation not on record	1

10 institutions · 780 of 780 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Amegilla niveata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

3. Shrubland | 3.5. Subtropical/Tropical Dry…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.9 °C 19.3–22.5

Seasonal swing summer↔winter15.1 °C

Max temp (day)27.4 °C 22.2–29.3

Min temp (night)14.8 °C 14.4–16.6

Precipitation47.3 mm/mo 23.6–52.3

Air humidity49.2 % 46.5–61.5

Moisture balance-105 mm/mo -149–-95.2

Vapour deficit1,253 Pa 865–1,470

Wind speed3.50 m/s 3.40–5.90

Cloud cover14.5 % 10.9–18.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)