Amegilla acraensis

(Fabricius, 1793) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Amegilla

At a glance

Occurrence records465

Data sources6

Biological traits0

DNA specimens14

eDNA detections6

Sources6 archives

Databases and archives Amegilla acraensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility465 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF465 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD14 specimens

01Narrative

Amegilla acraensis is een vliesvleugelig insect uit de familie bijen en hommels (Apidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1793 door Fabricius. De diersoort komt voor in Zimbabwe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amegilla acraensis has left across the world's sequence archives.

At a glance

DNA specimens14

BINs2

Marker genes1

eDNA detections6

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 52 variable positions, in barcode order

28Amostly conserved

40Cmostly conserved

88Cvariable

145Avariable

208Avariable

211Amostly conserved

213Tmostly conserved

218Gmostly conserved

238Cvariable

241Avariable

271Tmostly conserved

280Gvariable

293Cvariable

310Avariable

316Cvariable

322Gvariable

328Gmostly conserved

340Tvariable

343Avariable

352Avariable

370Tvariable

412Gvariable

433Gmostly conserved

460Amostly conserved

466Gvariable

526Amostly conserved

550Amostly conserved

559Gvariable

562Gmostly conserved

565Gvariable

577Avariable

589Cvariable

620Gvariable

628Amostly conserved

631Gvariable

632Gmostly conserved

633Amostly conserved

636Cmostly conserved

637Tvariable

638Amostly conserved

640Tmostly conserved

641Cmostly conserved

644Tmostly conserved

645Amostly conserved

646Cmostly conserved

647Cmostly conserved

648Amostly conserved

649Gvariable

650Cmostly conserved

651Amostly conserved

652Tmostly conserved

653Cmostly conserved

TATAATTTATTTTATTTTTGCTTTGTGAGCAGGTATAATCGGGTCTTCAATAAGTATATTAATTCGGATGGAATTAAGTGTTCCTGGCGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.1%

Haplotypes7

BINs2

Most divergent pair4.4%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amegilla mimadvenasame genus8.7%Anthophora quadrimaculatasame family16.0%Anthophora vannigerasame family16.3%Anthophora orientalissame family16.6%Amegilla quadrifasciatasame genus16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type465 records

Wild obs. + sensor56

Museum / vouchered409

Range

Area of Occupancy AOO952 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 43≤1 km 8≤10 km 1>10 km 1

53 georeferenced · 3 without coordinates

Open the mapobservation + sensor56

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤1 km 5≤10 km 9>10 km 2

16 georeferenced · 393 without coordinates

Open the institutions mapphysical evidence409

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ARC-Plant Protection Research Institute, National Collection of Fungi: Culture Collectionlocation not on record	82
Sydney, AU	74
Atlantic Reference Centrelocation not on record	67
Cape Town, ZA	43
	24
Durban Natural Science Museumlocation not on record	23
Wuzhou, CN	19
Beltsville, US	8
Cambridge, US	6
York University, Packer Collectionlocation not on record	1

10 institutions · 347 of 409 vouchered records shown · 62 without an institution code

09Environmental DNA6 detections

Where the DNA of Amegilla acraensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.1 °C 20.8–25.3

Seasonal swing summer↔winter5.10 °C

Max temp (day)28.2 °C 26.1–29.3

Min temp (night)16.7 °C 15.0–21.1

Precipitation43.1 mm/mo 21.1–108

Air humidity58.5 % 56.3–60.1

Moisture balance-96.3 mm/mo -111–-41.8

Vapour deficit1,091 Pa 1,016–1,364

Wind speed3.00 m/s 2.00–3.30

Cloud cover32.2 % 19.9–45.4

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)