Amegilla mimadvena

(Cockerell, 1916) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Amegilla

At a glance

Occurrence records97

Data sources7

Biological traits0

DNA specimens10

eDNA detections7

Sources7 archives

Databases and archives Amegilla mimadvena's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility97 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF97 records

Environmental DNA1 datasets · 3 countries7 detections

DNA & barcodingBOLD10 specimens

01Narrative

Amegilla mimadvena es una especie de abeja del género Amegilla, familia Apidae.Amegilla TSN 634005 Sistema Integrado de Información Taxonómica. Consultado el 2 de mayo de 2021.Amegilla Catalogue of Life. Consultado el 2 de mayo de 2021. Fue descrita científicamente por Cockerell en 1916.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amegilla mimadvena has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections7

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)2.8%

Haplotypes2

BIN1

Most divergent pair3.0%

Where individuals differ — all 21 variable positions, in barcode order

31Gvariable

43Avariable

271Tvariable

316Tvariable

379Avariable

604Tvariable

632Gvariable

633Avariable

636Avariable

638Avariable

640Cvariable

641Cvariable

644Avariable

645Avariable

646Cvariable

647Avariable

649Avariable

650Avariable

651Avariable

652Cvariable

653Cvariable

CATAATTTATTTTATTTTTGCTTTGTGAGCGGGTATAATTGGATCTTCAATAAGTATATTAATCCGGATGGAATTAAGTGTTCCTGGGGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amegilla acraensissame genus8.7%Anthophora pubescenssame family17.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type97 records

Wild obs. + sensor4

Museum / vouchered93

Range

Area of Occupancy AOO248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 3≤10 km 1

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 5>10 km 1

6 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence93

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ARC-Plant Protection Research Institute, National Collection of Fungi: Culture Collectionlocation not on record	28
Sydney, AU	25
Atlantic Reference Centrelocation not on record	19
Cape Town, ZA	6
Wuzhou, CN	5
Cambridge, US	4
Durban Natural Science Museumlocation not on record	4
Agricultural Research Council, South Africalocation not on record	2

8 institutions · 93 of 93 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Amegilla mimadvena was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 14.9–26.6

Seasonal swing summer↔winter9.90 °C

Max temp (day)29.2 °C 21.0–32.4

Min temp (night)20.2 °C 9.70–21.0

Precipitation158 mm/mo 41.4–174

Air humidity60.5 % 50.3–61.4

Moisture balance-8.20 mm/mo -105–37.9

Vapour deficit1,233 Pa 731–1,699

Wind speed2.30 m/s 1.80–2.40

Cloud cover64.0 % 33.8–70.8

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)