Amblyomma marmoreum

Koch, 1844 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Ixodida/Ixodidae/Amblyomma

At a glance

Occurrence records63

Data sources5

Biological traits0

DNA specimens46

eDNA detections45

Sources5 archives

Databases and archives Amblyomma marmoreum's data was compiled from.

GBIFGlobal Biodiversity Information Facility63 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics46 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF63 records

Environmental DNA1 datasets · 2 countries45 detections

DNA & barcodingBOLD46 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding46 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyomma marmoreum has left across the world's sequence archives.

At a glance

DNA specimens46

BINs4

Marker genes3

eDNA detections45

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P636 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.

Where individuals differ — all 106 variable positions, in barcode order

16Gmostly conserved

19Gmostly conserved

20Amostly conserved

22Tmostly conserved

24Tmostly conserved

28Tmostly conserved

34Amostly conserved

49Tmostly conserved

59Tmostly conserved

64Amostly conserved

77Cmostly conserved

79Tmostly conserved

85Tmostly conserved

88Tmostly conserved

91Tmostly conserved

106Amostly conserved

112Amostly conserved

115Tmostly conserved

121Cmostly conserved

142Cmostly conserved

166Gmostly conserved

169Amostly conserved

172Tmostly conserved

181Gmostly conserved

182Tmostly conserved

184Amostly conserved

185Amostly conserved

190Tmostly conserved

191Tmostly conserved

193Gmostly conserved

202Gmostly conserved

205Cmostly conserved

208Amostly conserved

211Tmostly conserved

217Tmostly conserved

220Tmostly conserved

251Tmostly conserved

253Amostly conserved

256Cmostly conserved

259Tmostly conserved

262Amostly conserved

263Cmostly conserved

272Tmostly conserved

274Amostly conserved

279Amostly conserved

280Tmostly conserved

283Tmostly conserved

287Tmostly conserved

290Amostly conserved

295Amostly conserved

301Amostly conserved

307Gmostly conserved

316Amostly conserved

319Tmostly conserved

325Cmostly conserved

328Tmostly conserved

331Amostly conserved

344Tmostly conserved

346Amostly conserved

349Gmostly conserved

354Amostly conserved

358Gmostly conserved

361Amostly conserved

364Tmostly conserved

367Amostly conserved

370Tmostly conserved

385Tmostly conserved

397Amostly conserved

400Amostly conserved

403Tmostly conserved

406Tmostly conserved

418Cmostly conserved

424Tmostly conserved

443Gmostly conserved

445Tmostly conserved

448Tmostly conserved

454Tmostly conserved

459Tmostly conserved

460Tmostly conserved

463Amostly conserved

479Amostly conserved

481Tmostly conserved

493Cmostly conserved

499Gmostly conserved

503Cmostly conserved

511Tmostly conserved

514Tmostly conserved

520Tmostly conserved

523Tmostly conserved

524Cmostly conserved

526Cmostly conserved

527Cmostly conserved

529Tmostly conserved

532Amostly conserved

544Gmostly conserved

553Cmostly conserved

565Tmostly conserved

571Amostly conserved

574Cmostly conserved

586Cmostly conserved

589Tmostly conserved

601Cmostly conserved

604Tmostly conserved

610Gmostly conserved

616Amostly conserved

619Cmostly conserved

TTTTGGAAGATGAGCGGGGATTATAGGTCTTTCAATAAGAATTTTAATTCGAATAGAATTAGGACAACCAGGTACACTTATTGGTAATGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.9%

Haplotypes3

BINs4

Most divergent pair5.3%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyomma sparsumsame genus1.9%Amblyomma sabaneraesame genus14.2%Amblyomma dissimilesame genus14.2%Haemaphysalis leachisame family14.5%Amblyomma testudinariumsame genus14.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type63 records

Wild obs. + sensor41

Museum / vouchered22

Range

Area of Occupancy AOO216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 25≤1 km 5≤10 km 3>10 km 4

37 georeferenced · 4 without coordinates

Open the mapobservation + sensor41

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 22 records without

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	13
Harold Winfred Manter Laboratory of Parasitologylocation not on record	3
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	3

3 institutions · 19 of 22 vouchered records shown · 3 without an institution code

09Environmental DNA45 detections

Where the DNA of Amblyomma marmoreum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map2 countries0

LembomboÂ Mountain Bushveld

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 19.6–22.6

Seasonal swing summer↔winter3.20 °C

Max temp (day)25.5 °C 24.5–25.9

Min temp (night)14.2 °C 14.2–19.8

Precipitation124 mm/mo 32.1–158

Air humidity57.8 % 54.3–60.5

Moisture balance-14.5 mm/mo -80.1–7.60

Vapour deficit1,093 Pa 980–1,103

Wind speed1.60 m/s 1.50–2.90

Cloud cover40.5 % 17.1–46.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)