Amazona tucumana

(Cabanis, 1885) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Psittaciformes/Psittacidae/Amazona

At a glance

Occurrence records3 584

Data sources9

Biological traits24

DNA specimens7

eDNA detections7

Sources9 archives

Databases and archives Amazona tucumana's data was compiled from.

WikipediaWikimedia Foundation12 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 584 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~1.45 Gbp↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Occurrence & distributionGBIF3 584 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD7 specimens

Genome at a glanceGoaT1.4 Gbp

01Narrative

The Tucumán amazon (Amazona tucumana), also known as the alder amazon, Tucumán parrot, or alder parrot, is a species of parrot in the family Psittacidae. It is mainly green and has red at the front of its head above its pale beak. It is found in woodland (especially with Alnus acuminata or Podocarpus parlatorei) in the Yungas of Argentina and Bolivia. It is threatened by habitat loss and capture for the parrot trade.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesEltonTraitsAmnioteDBAVONET

Size & morphology12

Beak depth22 mm

Beak length (culmen)27.8 mm

Beak length (nares)20.4 mm

Beak width14.8 mm

Body mass265 g

Hand-wing index38.5

Kipp's distance75.9 mm

SVL31.5 cm

Secondary length121 mm

Tail length107 mm

Tarsus length20.2 mm

Wing length197 mm

Life cycle & reproduction1

Litter size3.5

Diet & foraging7

Fruit30 %

Midhigh50 %

Plant other30 %

Seed40 %

Trophic levelherbivore

Trophic nicheOmnivore

Understory50 %

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size69 208 km²

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amazona tucumana has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes2

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P694 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.14%

Where individuals differ — all 1 variable positions, in barcode order

526Cvariable

CCTTTACCTAATTTTCGGTGCATGAGCCGGCATAATTGGTACCGCCCTAAGCTTACTCATTCGCGCAGAACTCGGCCAACCGGGGACTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amazona autumnalissame genus4.6%Amazona vinaceasame genus4.8%Amazona festivasame genus5.5%Amazona amazonicasame genus5.5%Amazona farinosasame genus5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Amazona tucumana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 447 440 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Amazona tucumana1.45 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type3 584 records

Wild obs. + sensor3 531

Museum / vouchered53

Origin

Native15

Range

Area of Occupancy AOO2 440 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy3% within 1 km

≤100 m 1≤1 km 2>10 km 89

92 georeferenced · 3 439 without coordinates

Open the mapobservation + sensor3 531

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤1 km 3≤10 km 31

34 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Buenos Aires, AR	27
Philadelphia, US	9
Seattle, US	4
Chicago, US	4
US	3
Ithaca, US	2
Paris, FR	1
Wuzhou, CN	1

8 institutions · 51 of 53 vouchered records shown · 2 without an institution code

09Environmental DNA7 detections

Where the DNA of Amazona tucumana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 14.5–14.5

Seasonal swing summer↔winter10.3 °C

Max temp (day)20.4 °C

Min temp (night)8.20 °C

Precipitation63.1 mm/mo

Air humidity60.4 %

Moisture balance-59.5 mm/mo

Vapour deficit655 Pa

Wind speed3.60 m/s

Cloud cover55.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amazona tucumana

At a glance

Sources9 archives

Size & morphology12

Life cycle & reproduction1

Diet & foraging7

Habitat & environment4

At a glance

Genome sizehow big the whole instruction manual is

Record type3 584 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 584 records