Amazona vinacea

(Kuhl, 1820) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Psittaciformes/Psittacidae/Amazona

At a glance

Occurrence records5 332

Data sources10

Biological traits25

DNA specimens4

eDNA detections4

Sources10 archives

Databases and archives Amazona vinacea's data was compiled from.

WikipediaWikimedia Foundation12 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 332 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF5 332 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD4 specimens

Genome at a glanceGoaT · NCBI≈1.1 Gbp

01Narrative

The vinaceous-breasted amazon (Amazona vinacea) is a species of parrot in the family Psittacidae. It is found in Argentina, Brazil, and Paraguay. Its natural habitats are subtropical or tropical moist lowland forest, subtropical or tropical moist montane forest, and plantations. It is threatened by habitat loss. The species is currently endangered and is also prevented from nesting due to competition with the African Queen Bees (Apis mellifera scutellata), an invasive species spread throughout South and Central America. The invasive species compete with the endangered species for nesting boxes, mostly cavities in trees, occupying them first or invading the other specie nests.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesEltonTraitsAmnioteDBAVONET

Size & morphology12

Beak depth26.7 mm

Beak length (culmen)33.5 mm

Beak length (nares)24.6 mm

Beak width16.2 mm

Body mass254 g

Hand-wing index31.6

Kipp's distance67.3 mm

SVL30 cm

Secondary length145 mm

Tail length122 mm

Tarsus length21.5 mm

Wing length214 mm

Life cycle & reproduction1

Litter size2.9

Diet & foraging8

Canopy30 %

Fruit40 %

Midhigh40 %

Plant other30 %

Seed30 %

Trophic levelherbivore

Trophic nicheOmnivore

Understory30 %

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size105 993 km²

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amazona vinacea has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes2

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P694 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.19%

Haplotypes2

BIN1

Most divergent pair0.29%

Where individuals differ — all 2 variable positions, in barcode order

628Avariable

667Gvariable

CCTTTACCTAATTTTCGGCGCATGAGCTGGCATAATTGGTACCGCCCTAAGCTTACTCATCCGCGCAGAACTCGGCCAACCAGGGACTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amazona tucumanasame genus4.8%Amazona farinosasame genus5.0%Amazona amazonicasame genus5.3%Amazona guildingiisame genus5.4%Amazona autumnalissame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_080983 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5CYTBND6rrn12rrn16

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Amazona vinacea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 101 684 052 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Amazona vinacea1.1 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 68 n = 34

Chromosome records68–702n range69median68mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 682×GoaT · Bird Chromosome Database

GoaT · Bird Chromosome Database — ↗

2n 702×GoaT · Bird Chromosome Database

GoaT · Bird Chromosome Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type5 332 records

Wild obs. + sensor5 285

Museum / vouchered45

Other2

Origin

Native23

Range

Area of Occupancy AOO4 480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy8% within 1 km

≤100 m 32≤1 km 1>10 km 395

428 georeferenced · 4 857 without coordinates

Open the mapobservation + sensor5 285

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 3≤1 km 1≤10 km 17

21 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence45

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Los Angeles, US	15
Chicago, US	9
Ann Arbor, US	6
Philadelphia, US	3
Buenos Aires, AR	3
New Haven, US	2
Paris, FR	1
Banyoles, ES	1
INMAlocation not on record	1
RBINS-Scientific Heritagelocation not on record	1
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	1
UNICAMPlocation not on record	1
Brussels, BE	1

13 institutions · 45 of 45 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Amazona vinacea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 15.9–15.9

Seasonal swing summer↔winter15.7 °C

Max temp (day)21.8 °C

Min temp (night)11.5 °C

Precipitation66.4 mm/mo

Air humidity54.7 %

Moisture balance-49.9 mm/mo

Vapour deficit875 Pa

Wind speed3.80 m/s

Cloud cover27.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amazona vinacea

At a glance

Sources10 archives

Size & morphology12

Life cycle & reproduction1

Diet & foraging8

Habitat & environment4

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type5 332 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 332 records