Amazona amazonica

(Linnaeus, 1766) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Psittaciformes/Psittacidae/Amazona

At a glance

Occurrence records108 790

Data sources11

Biological traits29

DNA specimens89

eDNA detections77

Sources11 archives

Databases and archives Amazona amazonica's data was compiled from.

WikipediaWikimedia Foundation12 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility108 790 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI77 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics89 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources29 traits

Occurrence & distributionGBIF108 790 records

Environmental DNA1 datasets · 4 countries77 detections

DNA & barcodingBOLD89 specimens

Genome at a glanceGoaT · NCBI1.4 Gbp

01Narrative

The orange-winged amazon (Amazona amazonica), also known locally as orange-winged parrot and loro guaro, is a large amazon parrot. It is a resident breeding bird in tropical South America, from Colombia, Trinidad and Tobago south to Peru, Bolivia and central Brazil. Its habitat is forest and semi-open country. Although common, it is persecuted as an agricultural pest and by capture for the pet trade (over 66,000 captured from 1981 to 1985). It is also hunted as a food source. Introduced breeding populations have been reported in Puerto Rico and Tenerife in the Canary Islands.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraitsAnAgeAVONET

Size & morphology14

Beak depth29.1 mm

Beak length (culmen)37.1 mm

Beak length (nares)29.6 mm

Beak width18.4 mm

Body mass370 g

Body mass (female)366 g

Body mass (male)384 g

Hand-wing index28.2

Kipp's distance56.9 mm

SVL32 cm

Secondary length145 mm

Tail length99.2 mm

Tarsus length21.4 mm

Wing length202 mm

Life cycle & reproduction5

Egg mass18.3 g

Fledging age60 days

Incubation21 days

Litter size3.2

Max. longevity360 months

Diet & foraging6

Canopy33 %

Fruit100 %

Midhigh33 %

Trophic levelherbivore

Trophic nicheFrugivore

Understory33 %

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size7 377 327 km²

05DNA & barcoding89 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amazona amazonica has left across the world's sequence archives.

At a glance

DNA specimens89

BINs1

Marker genes2

eDNA detections77

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus73 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

46Cmostly conserved

85Amostly conserved

162Amostly conserved

231Tmostly conserved

255Cmostly conserved

339Tmostly conserved

411Cmostly conserved

456Cmostly conserved

498Gmostly conserved

CTTTACCTAATTTTTGGCGCATGAGCTGGCATAATTGGTACCGCCCTAAGCTTACTCATCCGCGCAGAACTCGGCCAACCAGGAACCCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.60%

Haplotypes24

BIN1

Most divergent pair1.5%

S.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amazona guildingiisame genus2.3%Amazona farinosasame genus5.2%Amazona vinaceasame genus5.3%Amazona autumnalissame genus5.5%Amazona tucumanasame genus5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Amazona amazonica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 378 980 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Amazona amazonica1.38 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 68 n = 34

Chromosome records68–702n range69median68mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 682×GoaT · Bird Chromosome Database

GoaT · Bird Chromosome Database — ↗

2n 702×GoaT · Bird Chromosome Database

GoaT · Bird Chromosome Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type108 790 records

Wild obs. + sensor108 665

Museum / vouchered124

Cultivated / captive1

Origin

Native76

Range

Area of Occupancy AOO51 040 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 1 563≤1 km 592≤10 km 219>10 km 189

2 563 georeferenced · 106 102 without coordinates

Open the mapobservation + sensor108 665

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 1≤1 km 2≤10 km 32>10 km 4

39 georeferenced · 85 without coordinates

Open the institutions mapphysical evidence124

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	17
Paris, FR	13
Area metropolitana del Valle de Aburralocation not on record	11
Chicago, US	10
Denver, US	10
Universidad Industrial de Santander (UIS)location not on record	7
Ann Arbor, US	5
New Haven, US	5
Geneva, CH	4
Universidad de Caldas (UCaldas)location not on record	4
Vancouver, CA	3
INMAlocation not on record	3
Louisiana State University, Museum of Zoologylocation not on record	3
Washington, US	3
Seattle, US	3
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	2
US	2
Corporacion Autonoma Regional del Valle del Caucalocation not on record	2
Philadelphia, US	2
Cambridge, US	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
The University of the West Indies, Trinidad and Tobagolocation not on record	1
Pontificia Universidad Javeriana (PUJ)location not on record	1
RBINS-Scientific Heritagelocation not on record	1
PROMIGAS S.A. E.S.P. (Promigas)location not on record	1
Brussels, BE	1
Instituto de Investigacion de Recursos Biologicos Alexander von Humboldtlocation not on record	1
Centre for Biodiversity Genomics, Informatics Departmentlocation not on record	1
Toronto, CA	1
	1
University, National Zoological Collection of Surinamelocation not on record	1

31 institutions · 121 of 124 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA77 detections

Where the DNA of Amazona amazonica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found77

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 77 detections have coordinates

Open the map4 countries0

Indoors

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 12.9–25.7

Seasonal swing summer↔winter2.10 °C

Max temp (day)29.6 °C 17.2–30.1

Min temp (night)22.3 °C 8.10–22.8

Precipitation222 mm/mo 190–227

Air humidity64.7 % 62.4–68.7

Moisture balance76.9 mm/mo 65.6–110

Vapour deficit1,029 Pa 518–1,178

Wind speed2.10 m/s 0.6–2.80

Cloud cover56.3 % 36.7–68.7

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amazona amazonica

At a glance

Sources11 archives

Size & morphology14

Life cycle & reproduction5

Diet & foraging6

Habitat & environment4

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type108 790 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 31 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type108 790 records