Amazona festiva

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Psittaciformes/Psittacidae/Amazona

At a glance

Occurrence records9 783

Data sources10

Biological traits26

DNA specimens8

eDNA detections5

Sources10 archives

Databases and archives Amazona festiva's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 783 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Occurrence & distributionGBIF9 783 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD8 specimens

Genome at a glanceGoaT · NCBI≈1.2 Gbp

01Narrative

The festive amazon (Amazona festiva), also known as the festive parrot, is a species of parrot in the family Psittacidae. It is found in Brazil, Colombia, Ecuador, Bolivia, Guyana, Peru, and Venezuela. It is associated with forest (especially Várzea) and woodland growing near major rivers. Locally it is also found in coastal mangroves (primarily in Amapá). There are two subspecies; A. f. festiva and A. f. bodini.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraitsAnAgeAVONET

Size & morphology12

Beak depth28.9 mm

Beak length (culmen)36.7 mm

Beak length (nares)29.5 mm

Beak width16.6 mm

Body mass430 g

Body mass (male)430 g

Hand-wing index29

Kipp's distance58.2 mm

Secondary length142 mm

Tail length100 mm

Tarsus length24.1 mm

Wing length198 mm

Life cycle & reproduction1

Max. longevity294 months

Diet & foraging9

Canopy30 %

Fruit60 %

Ground10 %

Midhigh40 %

Plant other10 %

Seed30 %

Trophic levelherbivore

Trophic nicheFrugivore

Understory20 %

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size689 103 km²

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amazona festiva has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes2

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.93%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 11 variable positions, in barcode order

42Cvariable

69Gvariable

96Gvariable

111Tvariable

159Avariable

180Gvariable

298Amostly conserved

327Amostly conserved

414Gmostly conserved

546Gmostly conserved

573Amostly conserved

CTCTACCTAATTTTCGGCGCATGAGCTGGCATAATTGGTACCGCCCTAAGCTTACTCATTCGCGCAGAGCTCGGCCAACCAGGAACCCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amazona tucumanasame genus5.5%Amazona amazonicasame genus5.5%Amazona farinosasame genus5.5%Amazona ochrocephalasame genus5.6%Amazona guildingiisame genus5.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Amazona festiva carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 151 095 286 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Amazona festiva1.15 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 68 n = 34

Chromosome records68–702n range69median68mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 682×GoaT · Bird Chromosome Database

GoaT · Bird Chromosome Database — ↗

2n 702×GoaT · Bird Chromosome Database

GoaT · Bird Chromosome Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type9 783 records

Wild obs. + sensor9 769

Museum / vouchered14

Origin

Native7

Range

Area of Occupancy AOO9 344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy4% within 1 km

≤100 m 4≤1 km 4>10 km 178

186 georeferenced · 9 583 without coordinates

Open the mapobservation + sensor9 769

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	4
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	3
Paris, FR	2
Instituto de Investigacion de Recursos Biologicos Alexander von Humboldtlocation not on record	1
Universidad de Caldas (UCaldas)location not on record	1
Ann Arbor, US	1
Louisiana State University, Museum of Zoologylocation not on record	1
Chicago, US	1

8 institutions · 14 of 14 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Amazona festiva was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 23.3–25.8

Seasonal swing summer↔winter2.70 °C

Max temp (day)27.9 °C 26.9–28.9

Min temp (night)21.8 °C 20.8–22.8

Precipitation315 mm/mo 272–358

Air humidity71.0 % 68.2–73.7

Moisture balance196 mm/mo 147–245

Vapour deficit907 Pa 754–1,061

Wind speed1.70 m/s 1.50–1.90

Cloud cover53.5 % 47.0–60.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amazona festiva

At a glance

Sources10 archives

Size & morphology12

Life cycle & reproduction1

Diet & foraging9

Habitat & environment4

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type9 783 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 783 records