Amazona ochrocephala

(Gmelin, 1788) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Psittaciformes/Psittacidae/Amazona

At a glance

Occurrence records101 319

Data sources11

Biological traits31

DNA specimens210

eDNA detections38

Sources11 archives

Databases and archives Amazona ochrocephala's data was compiled from.

WikipediaWikimedia Foundation13 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility101 319 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics210 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements4 literature sources31 traits

Occurrence & distributionGBIF101 319 records

Environmental DNA1 datasets · 1 countries38 detections

DNA & barcodingBOLD210 specimens

Genome at a glanceGoaT · NCBI1.7 Gbp

01Narrative

The yellow-crowned amazon or yellow-crowned parrot (Amazona ochrocephala) is a species of parrot native to tropical South America, Panama and Trinidad and Tobago. The taxonomy is highly complex and the yellow-headed (A. oratrix) and yellow-naped amazon (A. auropalliata) are sometimes considered subspecies of the yellow-crowned amazon. Except in the taxonomic section, the following deals only with the nominate group (including subspecies xantholaema, nattereri and panamensis).They are found in the Amazon basin.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraitsAnAgeAVONET

Size & morphology13

Beak depth32.9 mm

Beak length (culmen)38.3 mm

Beak length (nares)32.6 mm

Beak width19.7 mm

Body mass430 g

⚠ sources differ — AnAge: 430 g · AmnioteDB: 432 g · AVONET: 477 g · EltonTraits: 477 g

Body mass (female)429 g

Hand-wing index28.3

Kipp's distance60.8 mm

SVL36.5 cm

Secondary length155 mm

Tail length116 mm

Tarsus length22 mm

Wing length213 mm

Life cycle & reproduction6

Egg mass19.3 g

Fledging age60 days

Growth rate0.158 /day

Incubation29 days

Litter size3

Max. longevity672 months

Diet & foraging8

Fruit40 %

Ground33 %

Midhigh33 %

Plant other30 %

Seed30 %

Trophic levelherbivore

Trophic nicheOmnivore

Understory33 %

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size6 626 118 km²

05DNA & barcoding210 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amazona ochrocephala has left across the world's sequence archives.

At a glance

DNA specimens210

BINs2

Marker genes12

eDNA detections38

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus143 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

15Cmostly conserved

18Cvariable

60Cvariable

69Gvariable

111Cmostly conserved

153Tvariable

259Tvariable

318Cmostly conserved

348Cmostly conserved

357Amostly conserved

408Tmostly conserved

471Cvariable

531Gvariable

615Avariable

CTTTACCTAATTTTCGGCGCATGAGCTGGCATAATTGGTACCGCCCTAAGTTTACTCATCCGCGCAGAGCTTGGCCAACCAGGAACCCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.93%

Haplotypes26

BINs2

Most divergent pair6.1%

S.AmericaOtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amazona aestivasame genus1.5%Amazona autumnalissame genus5.0%Amazona farinosasame genus5.0%Amazona guildingiisame genus5.5%Amazona festivasame genus5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_027840 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5CYTBND612S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Amazona ochrocephala carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 740 840 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Amazona ochrocephala1.74 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 70 n = 35

Chromosome records70–702n range70median70mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 704×GoaT · Animal Chromosome Counts Database · GoaT · Bird Chromosome Database · GoaT · Animal Genome Size Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Bird Chromosome Database — ↗

GoaT · Animal Genome Size Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type101 319 records

Wild obs. + sensor101 129

Museum / vouchered190

Origin

Native113

Range

Area of Occupancy AOO50 592 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy23% within 1 km

≤100 m 319≤1 km 73≤10 km 21>10 km 1 304

1 717 georeferenced · 99 412 without coordinates

Open the mapobservation + sensor101 129

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 4≤1 km 9≤10 km 41>10 km 9

63 georeferenced · 127 without coordinates

Open the institutions mapphysical evidence190

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	28
Philadelphia, US	14
Louisiana State University, Museum of Zoologylocation not on record	11
Los Angeles, US	10
US	10
Area metropolitana del Valle de Aburralocation not on record	10
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	9
Cambridge, US	8
Corporacion Autonoma Regional del Cesarlocation not on record	6
Seattle, US	6
Ohio State University - Bird Division, Columbus, OH (OSUM)location not on record	5
Universidad de Caldas (UCaldas)location not on record	5
Corporacion Autonoma Regional del Valle del Caucalocation not on record	4
Ann Arbor, US	4
Universidad Industrial de Santander (UIS)location not on record	4
Delaware Museum of Nature and Sciencelocation not on record	4
Paris, FR	3
Denver, US	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
Universidad de los Llanos (UniLlanos)location not on record	3
Toronto, CA	3
Mongolian Museum of Natural Historylocation not on record	2
Brussels, BE	2
Musée des Confluenceslocation not on record	2
San Diego, US	2
RBINS-Scientific Heritagelocation not on record	2
Washington State University, Charles R. Conner Museumlocation not on record	1
PROMIGAS S.A. E.S.P. (Promigas)location not on record	1
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	1
Universidad del Tolima (UT)location not on record	1
Instituto de Investigacion de Recursos Biologicos Alexander von Humboldtlocation not on record	1
Honolulu, US	1
Ithaca, US	1
Texas Cooperative Wildlife Collectionlocation not on record	1
University of Nebraska State Museumlocation not on record	1
Instituto Tecnológico Metropolitanolocation not on record	1
Vancouver, CA	1
Bourges, FR	1
CASlocation not on record	1
Washington, US	1

40 institutions · 177 of 190 vouchered records shown · 13 without an institution code

09Environmental DNA38 detections

Where the DNA of Amazona ochrocephala was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 25.6–25.6

Seasonal swing summer↔winter3.60 °C

Max temp (day)29.6 °C

Min temp (night)22.3 °C

Precipitation222 mm/mo

Air humidity64.7 %

Moisture balance67.7 mm/mo

Vapour deficit1,175 Pa

Wind speed2.60 m/s

Cloud cover68.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amazona ochrocephala

At a glance

Sources11 archives

Size & morphology13

Life cycle & reproduction6

Diet & foraging8

Habitat & environment4

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type101 319 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 40 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type101 319 records