Amazona oratrix

Ridgway, 1887 · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Psittaciformes/Psittacidae/Amazona

At a glance

Occurrence records13 831

Data sources11

Biological traits31

DNA specimens99

eDNA detections13

Sources11 archives

Databases and archives Amazona oratrix's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 831 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics99 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Occurrence & distributionGBIF13 831 records

Environmental DNA1 datasets · 0 countries13 detections

DNA & barcodingBOLD99 specimens

Genome at a glanceGoaT · NCBI1.7 Gbp

01Narrative

The yellow-headed amazon (Amazona oratrix), also known as the yellow-headed parrot and double yellow-headed amazon, is an endangered amazon parrot of Mexico and northern Central America. Measuring 38 - in length, it is a stocky short-tailed green parrot with a yellow head. It prefers to live in mangrove forests or forests near rivers or other bodies of water. It is sometimes considered a subspecies of the yellow-crowned amazon (Amazona ochrocephala). It is a popular pet and an excellent talker. Poaching for the international pet trade has driven the species to near-extinction in the wild; around half of all wild-caught birds are thought to die in the process.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAnAgeAVONETEltonTraits

Size & morphology14

Beak depth32.6 mm

Beak length (culmen)39.3 mm

Beak length (nares)31.6 mm

Beak width18.4 mm

Body mass517 g

⚠ sources differ — AnAge: 517 g · AmnioteDB: 435 g · AVONET: 477 g · EltonTraits: 477 g

Body mass (female)429 g

Body mass (male)517 g

Hand-wing index34.8

Kipp's distance76.7 mm

SVL35.75 cm

Secondary length144 mm

Tail length119 mm

Tarsus length25.9 mm

Wing length223 mm

Life cycle & reproduction5

Egg mass19.3 g

Fledging age60 days

Incubation29 days

Litter size3

Max. longevity672 months

Diet & foraging8

Fruit40 %

Ground33 %

Midhigh33 %

Plant other30 %

Seed30 %

Trophic levelherbivore

Trophic nicheOmnivore

Understory33 %

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size48 120 km²

05DNA & barcoding99 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amazona oratrix has left across the world's sequence archives.

At a glance

DNA specimens99

BINs1

Marker genes2

eDNA detections13

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P694 bp consensus85 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

25Amostly conserved

49Gvariable

112Cvariable

115Tvariable

295Cvariable

307Gvariable

316Gvariable

391Tmostly conserved

469Avariable

ACTTTACCTAATTTTCGGCGCATGAGCTGGCATAATTGGTACCGCCCTGAGTTTACTCATTCGCGCAGAGCTTGGCCAACCAGGAACCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.59%

Haplotypes14

BIN1

Most divergent pair1.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amazona farinosasame genus5.2%Amazona autumnalissame genus5.5%Amazona tucumanasame genus6.1%Amazona festivasame genus6.1%Amazona amazonicasame genus6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Amazona oratrix carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 701 720 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Amazona oratrix1.7 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type13 831 records

Wild obs. + sensor13 647

Museum / vouchered173

Other11

Origin

Native13

Range

Area of Occupancy AOO5 488 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 419≤1 km 1 041≤10 km 91>10 km 620

2 171 georeferenced · 11 476 without coordinates

Open the mapobservation + sensor13 647

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 118≤1 km 3≤10 km 15>10 km 2

138 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence173

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	19
Moore Laboratory of Zoology, Occidental Collegelocation not on record	17
	16
Delaware Museum of Nature and Sciencelocation not on record	12
Ann Arbor, US	9
Wuzhou, CN	7
Louisiana State University, Museum of Zoologylocation not on record	7
Cambridge, US	4
Chicago, US	4
Ciudad de México, MX	3
US	3
Seattle, US	2
Toronto, CA	2
Mexico City, MX	2
Ithaca, US	2
Iowa City, US	1
Cincinnati Museum Centerlocation not on record	1
University of California Los Angeleslocation not on record	1
Mongolian Museum of Natural Historylocation not on record	1
Mexico City, MX	1
Geneva, CH	1
Ohio State University - Bird Division, Columbus, OH (OSUM)location not on record	1
Paris, FR	1
Washington, US	1

24 institutions · 118 of 173 vouchered records shown · 55 without an institution code

09Environmental DNA13 detections

Where the DNA of Amazona oratrix was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amazona oratrix

At a glance

Sources11 archives

Size & morphology14

Life cycle & reproduction5

Diet & foraging8

Habitat & environment4

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type13 831 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type13 831 records