Amaurobius similis

(Blackwall, 1861) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Amaurobiidae/Amaurobius

At a glance

Occurrence records4 041

Data sources8

Biological traits49

DNA specimens21

eDNA detections21

Sources8 archives

Databases and archives Amaurobius similis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 041 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

World Spider Trait DBMasaryk University49 traits · 25 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements25 literature sources49 traits

Occurrence & distributionGBIF4 041 records

Environmental DNA1 datasets · 5 countries21 detections

DNA & barcodingBOLD21 specimens

01Narrative

Amaurobius similis is a species of spider in the family Amaurobiidae. It is one of at least two common spiders found in houses known as lace-webbed spiders. The specific name similis is based on its similarity to the species Amaurobius fenestralis. Both are often found near windows, hence the specific name of A. fenestralis.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 25 sources

Wolff et al. 2022Bruun & Lissner 2019Liste France 2018Harvey et al. 2017Henriksen & Hilmo 2015SLU 2020Maelfait et al. 1998Blick et al. 2016Nährig et al. 2003Blick & Scheidler 2004Kielhorn 2017Finch 2004Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Petrischak 2013Almquist 2006Rayner, Vitkauskaite, Healy, Lyons, McSharNentwig et al. 2018Koch 1868Rayner,, Vitkauskaite,, Healy,, Lyons, K.Cardoso et al. 2011Pekár et al. 2012a

Morphometry39

ALE0.15 mm

AME0.14 mm

Abdomen height3.04 mm

Abdomen length4.53 mm

Abdomen width3.7 mm

Body length♀9.8·♂7.25·Both9.36 mm

Cephalothorax height2.55 mm

Cephalothorax length4.38 mm

Cephalothorax width3.11 mm

Chelicerae basal part (paturon) length1.86 mm

Cribellum width0.72 mm

Fang length0.48 mm

Femur I length3.26 mm

Femur I width0.77 mm

Femur II length3.22 mm

Femur IV length3.32 mm

Femur IV width0.85 mm

Leg I length12.75 mm

Leg II length11.98 mm

Leg III length10.5 mm

Leg IV length12.5 mm

Metatarsus I length2.71 mm

Metatarsus II length2.41 mm

Metatarsus III length2.12 mm

Metatarsus IV length2.58 mm

PLE0.13 mm

PME0.13 mm

Patella I length1.44 mm

Patella II length1.45 mm

Patella IV length1.5 mm

Spinneret PLS0.61 mm

Tarsus I length1.41 mm

Tarsus II length1.41 mm

Tarsus IV length1.31 mm

Tibia I length2.77 mm

Tibia I width0.465 mm

Tibia II length2.47 mm

Tibia IV length2.68 mm

Tibia IV width0.55 mm

Predation4

Hunting guildsheet web weavers

Hunting guild 2sheet web builder

Prey diversity11 mm

Web buildingyes

Ecology2

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categorySave or at low risk (SA)

Physiology2

Venom toxicity128 mm

Venom yield0.014 mm

Biomechanics1

'Primary mode of locomotionwalking

Morphology1

Cribellumpresent

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amaurobius similis has left across the world's sequence archives.

At a glance

DNA specimens21

BINs2

Marker genes2

eDNA detections21

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 65 variable positions, in barcode order

1Gmostly conserved

3Cmostly conserved

22Gmostly conserved

40Gmostly conserved

55Tmostly conserved

94Amostly conserved

100Amostly conserved

145Amostly conserved

184Amostly conserved

241Amostly conserved

364Gmostly conserved

406Tmostly conserved

478Gmostly conserved

490Gmostly conserved

541Amostly conserved

550Amostly conserved

579Tmostly conserved

582Tmostly conserved

587Gmostly conserved

588Amostly conserved

589Tmostly conserved

590Cmostly conserved

591Gmostly conserved

595Tmostly conserved

599Amostly conserved

600Amostly conserved

602Amostly conserved

604Tmostly conserved

605Tmostly conserved

606Cmostly conserved

609Tmostly conserved

611Tmostly conserved

613Tmostly conserved

615Amostly conserved

616Cmostly conserved

617Cmostly conserved

618Cmostly conserved

619Tmostly conserved

620Gmostly conserved

623Gmostly conserved

624Gmostly conserved

625Amostly conserved

626Gmostly conserved

627Gmostly conserved

628Gmostly conserved

630Gmostly conserved

631Gmostly conserved

632Gmostly conserved

633Amostly conserved

634Tmostly conserved

636Cmostly conserved

637Tmostly conserved

638Amostly conserved

639Tmostly conserved

640Tmostly conserved

642Tmostly conserved

643Amostly conserved

646Tmostly conserved

647Cmostly conserved

648Amostly conserved

649Amostly conserved

653Tmostly conserved

654Tmostly conserved

655Amostly conserved

657Tmostly conserved

GACATTATATTTAATTTTTGGGGCTTGATCTTCTATAGTGGGAATAGCTATAAGTGTTTTAATTCGAGTAGAATTAGGGCAATCTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes3

BINs2

Most divergent pair2.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amaurobius obustussame genus5.8%Amaurobius fenestralissame genus6.7%Amaurobius pallidussame genus6.7%Amaurobius erberisame genus7.0%Amaurobius strandisame genus7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type4 041 records

Wild obs. + sensor3 649

Museum / vouchered392

Origin

Native31

Introduced1

Range

Area of Occupancy AOO8 448 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 1 016≤1 km 306≤10 km 1 648>10 km 40

3 010 georeferenced · 639 without coordinates

Open the mapobservation + sensor3 649

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 20≤1 km 28≤10 km 255>10 km 1

304 georeferenced · 88 without coordinates

Open the institutions mapphysical evidence392

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussels, BE	136
Copenhagen, DK	23
Natural History Museum Rotterdamlocation not on record	21
Paro, BT	19
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	9
Bonn, DE	9
Tilburg, NL	8
Frankfurt am Main	7
SLU Artdatabankenlocation not on record	5
Bern, CH	4
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	4
	4
Liverpool, GB	3
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	3
Buenos Aires, AR	2
SNSB-Zoologische Staatssammlung Münchenlocation not on record	2
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	2
Paris, FR	1
Helsinki, FI	1
Ekaterinburg, RU	1
South Kensington, GB	1

21 institutions · 265 of 392 vouchered records shown · 127 without an institution code

09Environmental DNA21 detections

Where the DNA of Amaurobius similis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map5 countries0

UrbanHausfassadeParkSynanthrop in/am Haus

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.2 °C 8.20–13.7

Seasonal swing summer↔winter14.7 °C

Max temp (day)15.5 °C 11.1–17.9

Min temp (night)8.40 °C 5.10–9.10

Precipitation63.0 mm/mo 54.6–84.4

Air humidity61.1 % 59.6–64.4

Moisture balance-45.2 mm/mo -53.5–12.2

Vapour deficit558 Pa 416–639

Wind speed4.10 m/s 3.40–5.80

Cloud cover40.3 % 37.4–51.4

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amaurobius similis

At a glance

Sources8 archives

Morphometry39

Predation4

Ecology2

Physiology2

Biomechanics1

Morphology1

At a glance

Record type4 041 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 041 records