Amaurobius pallidus

L.Koch, 1868 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Amaurobiidae/Amaurobius

At a glance

Occurrence records21

Data sources8

Biological traits2

DNA specimens10

eDNA detections10

Sources8 archives

Databases and archives Amaurobius pallidus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility21 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

World Spider Trait DBMasaryk University2 traits · 4 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources2 traits

Occurrence & distributionGBIF21 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD10 specimens

01Narrative

Amaurobius pallidus is a species of spider in the family Amaurobiidae, found in Southeastern Europe to Georgia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGajdoš et al. 2014Gajdoš & Svatoň 2001Finch 2004Buchholz et al. 2011

Ecology2

Regional IUCN Red List categoryData Deficient (DD)

Regional non-IUCN Red List categoryData Deficient (D)

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amaurobius pallidus has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections10

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)0.95%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 17 variable positions, in barcode order

1Amostly conserved

24Cmostly conserved

82Gvariable

88Gvariable

97Tmostly conserved

112Amostly conserved

130Amostly conserved

181Gvariable

265Amostly conserved

307Amostly conserved

316Avariable

343Tmostly conserved

358Gvariable

430Gmostly conserved

478Gvariable

487Gvariable

562Gvariable

AACATTATATTTAATTTTTGGGGCTTGAGCTTCAATAGTAGGAATAGCTATAAGAGTTTTAATTCGTGTAGAATTAGGACAGTCAGGGAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amaurobius similissame genus6.7%Amaurobius obustussame genus7.4%Amaurobius strandisame genus7.9%Amaurobius caucasicussame genus8.1%Amaurobius erberisame genus8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type21 records

Wild obs. + sensor8

Museum / vouchered13

Range

Area of Occupancy AOO76 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 3≤1 km 2≤10 km 3

8 georeferenced

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 13 records without

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA10 detections

Where the DNA of Amaurobius pallidus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.5 °C 1.20–16.3

Seasonal swing summer↔winter21.3 °C

Max temp (day)12.7 °C 5.10–20.4

Min temp (night)8.20 °C -2.50–10.4

Precipitation48.8 mm/mo 34.8–73.0

Air humidity61.8 % 59.1–63.0

Moisture balance29.2 mm/mo

Vapour deficit469 Pa 255–763

Wind speed2.10 m/s

Cloud cover43.2 % 42.5–63.1

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)