Amaurobius erberi

(Keyserling, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Amaurobiidae/Amaurobius

At a glance

Occurrence records2 561

Data sources9

Biological traits4

DNA specimens12

eDNA detections4

Sources9 archives

Databases and archives Amaurobius erberi's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 561 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

World Spider Trait DBMasaryk University4 traits · 4 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources4 traits

Occurrence & distributionGBIF2 561 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD12 specimens

01Narrative

Amaurobius erberi is a species of spider in the family Amaurobiidae, found in Europe and the Canary Islands. A. erberi is very similar to A. similis and A. fenestralis in general appearance. The epigyne is separated from that of A. fenestralis by the outlines of the spermathecaa which extend well ahead of the anterior margin. The male palps are similar to that of A. similus but, from above, the thin apophysis is longer. The males are mature in autumn and the females are probably mature throughout the year. It is generally found under stones and logs and in leaf litter.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBuchar & Růžička 2002Gajdoš et al. 2014Gajdoš & Svatoň 2001Řezáč et al. 2015

Ecology4

Light 2shaded

Moisture 2semi-humid

Regional IUCN Red List categoryCritically Endangered (CR)

Regional non-IUCN Red List categoryCritically Endangered (CR)

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amaurobius erberi has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes1

eDNA detections4

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

79Avariable

121Amostly conserved

178Tvariable

190Amostly conserved

202Amostly conserved

220Avariable

259Cvariable

265Amostly conserved

289Gvariable

290Amostly conserved

322Gvariable

343Tmostly conserved

346Tmostly conserved

373Gvariable

406Tmostly conserved

433Gvariable

483Cmostly conserved

541Avariable

556Tmostly conserved

562Gvariable

616Tmostly conserved

GACATTATATTTGATTTTTGGAGCTTGGGCTTCTATAGTTGGAATAGCAATAAGAGTTTTAATTCGGGTAGAATTAGGACAATCGGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes3

BINs2

Most divergent pair0.31%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amaurobius obustussame genus7.0%Amaurobius similissame genus7.0%Amaurobius strandisame genus8.4%Amaurobius pallidussame genus8.5%Amaurobius fenestralissame genus8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 561 records

Wild obs. + sensor2 326

Museum / vouchered223

Other12

Origin

Native2

Range

Area of Occupancy AOO4 076 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy30% within 1 km

≤100 m 351≤1 km 196≤10 km 1 261>10 km 37

1 845 georeferenced · 481 without coordinates

Open the mapobservation + sensor2 326

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 2≤1 km 15≤10 km 110>10 km 3

130 georeferenced · 93 without coordinates

Open the institutions mapphysical evidence223

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	14
Frankfurt am Main	9
Bonn, DE	7
	7
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	4
Washington, US	3
Brussels, BE	2
Buenos Aires, AR	1
Tartu, EE	1
SLU Artdatabankenlocation not on record	1
Copenhagen, DK	1

11 institutions · 50 of 223 vouchered records shown · 173 without an institution code

09Environmental DNA4 detections

Where the DNA of Amaurobius erberi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

Dry acidic grasslandsRiparian forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.9 °C 12.9–15.1

Seasonal swing summer↔winter17.7 °C

Max temp (day)18.5 °C 16.4–18.9

Min temp (night)8.70 °C 7.90–11.0

Precipitation121 mm/mo 103–155

Air humidity60.0 % 58.7–60.1

Moisture balance53.2 mm/mo 21.3–71.0

Vapour deficit694 Pa 606–719

Wind speed2.30 m/s 2.10–3.00

Cloud cover45.3 % 39.9–46.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amaurobius erberi

At a glance

Sources9 archives

Ecology4

At a glance

Record type2 561 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 561 records