Amaurobius fenestralis

(Ström, 1768) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Amaurobiidae/Amaurobius

At a glance

Occurrence records6 469

Data sources9

Biological traits37

DNA specimens45

eDNA detections307

Sources9 archives

Databases and archives Amaurobius fenestralis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 469 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI307 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics45 specimens↗

World Spider Trait DBMasaryk University37 traits · 31 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements31 literature sources37 traits

Occurrence & distributionGBIF6 469 records

Environmental DNA5 datasets · 11 countries307 detections

DNA & barcodingBOLD45 specimens

01Narrative

Amaurobius fenestralis is a species of spider in the family Amaurobiidae. It is one of at least two common spiders found in houses known as lace-webbed spider, the other being Amaurobius similis. The specific name similis is based on its similarity to A. fenestralis. Both are often found near windows, hence the specific name of A. fenestralis. The two species are difficult to distinguish: A. fenestralis tends to be smaller and lighter in colouration when an adult. Both species have V-shaped markings on their abdomens, with A. fenestralis usually having two or three, and A. similis four. Examination of the genitalia may be needed for precise identification. This spider has been seen preying on another spider, Steatoda nobilis in areas around the UK.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 31 sources

Wolff et al. 2022Birkhofer et al. 2017Entling et al. 2007Buchar & Růžička 2002Harvey et al. 2017Bruun & Lissner 2019SLU 2020Staręga et al. 2001Henriksen & Hilmo 2015Gajdoš et al. 2014Hyvärinen et al. 2019Kielhorn 2017Finch 2004Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Liste France 2018Maelfait et al. 1998Blick & Scheidler 2004Blick et al. 2016Řezáč et al. 2015Wunderlich 1982Wolff et al. 2019Wiehle 1953Almquist 2006Menge 1871Nentwig et al. 2018Koch 1868Cardoso et al. 2011

Morphometry23

ALE0.18 mm

AME0.15 mm

Abdomen length4.25 mm

Abdomen width3.25 mm

Body length♀8.05·♂5.5 mm

Cephalothorax length4 mm

Cephalothorax width2.4 mm

Leg I length11 mm

Leg II length10.25 mm

Leg III length8.75 mm

Leg IV length9.25 mm

Metatarsus I length2.03 mm

Metatarsus IV length1.48 mm

PLE0.16 mm

PME0.16 mm

Tarsus I length1.12 mm

Tarsus IV length1.01 mm

Tibia I length2.09 mm

Tibia I width0.33 mm

Tibia II length1.67 mm

Tibia III length1.38 mm

Tibia IV length1.88 mm

Tibia IV width0.34 mm

Predation4

Hunting guildsheet web weavers

Hunting guild 2sheet web builder

Simple hunting guild classificationcursorial

Web buildingyes

Ecology8

Ballooninghigh

Light0.375 mm

Light 2shaded

Moisture 10.625 mm

Moisture 2dry

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryLeast Concern (*)

Stratumsoil

Biomechanics1

'Primary mode of locomotionwalking

Morphology1

Cribellumpresent

05DNA & barcoding45 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amaurobius fenestralis has left across the world's sequence archives.

At a glance

DNA specimens45

BINs2

Marker genes1

eDNA detections307

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus45 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

280Gmostly conserved

283Gmostly conserved

298Cmostly conserved

535Gmostly conserved

AACATTATATTTAATTTTTGGAGCTTGAGCATCTATAGTTGGAATAGCTATAAGTGTTTTAATTCGAATTGAATTAGGGCAATCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes8

BINs2

Most divergent pair6.8%

EuropeAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amaurobius obustussame genus6.1%Amaurobius similissame genus6.7%Amaurobius strandisame genus8.1%Amaurobius pallidussame genus8.7%Amaurobius erberisame genus8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type6 469 records

Wild obs. + sensor5 282

Museum / vouchered1 172

Cultivated / captive11

Other4

Origin

Native297

Range

Area of Occupancy AOO10 960 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 2 163≤1 km 1 191≤10 km 1 660>10 km 8

5 022 georeferenced · 260 without coordinates

Open the mapobservation + sensor5 282

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 220≤1 km 44≤10 km 477>10 km 18

759 georeferenced · 413 without coordinates

Open the institutions mapphysical evidence1 172

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 11 records without

Open the mapnot free-living11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussels, BE	352
SLU Artdatabankenlocation not on record	178
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	136
Adam Mickiewicz University in Poznańlocation not on record	54
Paro, BT	36
Frankfurt am Main	33
Bonn, DE	30
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	24
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	24
Bern, CH	22
Copenhagen, DK	21
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	21
Akademia Pomorska w Słupskulocation not on record	20
Helsinki, FI	17
Provincia di Livornolocation not on record	15
	12
MZLUlocation not on record	8
European Distributed Institute of Taxonomy (EDIT)location not on record	4
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	4
Zoologisches Museum Hamburglocation not on record	4
Tartu, EE	4
neflocation not on record	4
Musee d'Histoire Naturallelocation not on record	4
Washington, US	3
BioFokuslocation not on record	3
ZSMlocation not on record	3
SNSB-Zoologische Staatssammlung Münchenlocation not on record	3
Tilburg, NL	2
Liverpool, GB	2
Uniwersytet w Białymstokulocation not on record	2
University of Tokyo, Department of Zoologylocation not on record	1
SNSDlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
South Kensington, GB	1
Paris, FR	1

35 institutions · 1 050 of 1 172 vouchered records shown · 122 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA307 detections

Where the DNA of Amaurobius fenestralis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found307

Studies independent surveys5

Countries11

Verifiable raw sequence linked263

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 307 detections have coordinates

Open the map11 countries0

1. Forest & Woodland|1.4. Temperate Forestmixed forest (maily Picea abies), clearings,…NaturhÃ¶hle, 7722/01Gemauerter Tunnel, 5425/904Buchenwald

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.8 °C 5.20–15.8

Seasonal swing summer↔winter19.5 °C

Max temp (day)14.9 °C 8.70–18.7

Min temp (night)8.00 °C 2.10–12.2

Precipitation68.5 mm/mo 36.5–99.3

Air humidity61.3 % 57.1–65.4

Moisture balance2.40 mm/mo -50.1–36.0

Vapour deficit507 Pa 360–677

Wind speed3.00 m/s 2.50–4.20

Cloud cover51.7 % 43.0–55.8

CHELSA 1981–2010, ~9 km grid, at location & month of 304 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amaurobius fenestralis

At a glance

Sources9 archives

Morphometry23

Predation4

Ecology8

Biomechanics1

Morphology1

At a glance

Record type6 469 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 35 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 469 records