Altica torquata

J.L.LeConte, 1858 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Altica

At a glance

Occurrence records276

Data sources5

Biological traits0

DNA specimens4

eDNA detections0

Sources5 archives

Databases and archives Altica torquata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility276 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF276 records

DNA & barcodingBOLD4 specimens

01Narrative

Altica torquata, the steel-blue grapevine flea beetle, is a species of flea beetle in the family Chrysomelidae. It is found in Central America, North America, and Oceania.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Altica torquata has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.30%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 4 variable positions, in barcode order

415Gmostly conserved

433Gmostly conserved

447Tmostly conserved

619Gmostly conserved

AACTTTATACTTTTTATTTGGAATTTGAGCTGGGATAATTGGTACCTCCATAAGACTTTTAATTCGTACAGAATTAGGAAGACCAGGCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Altica tombacinasame genus4.6%Altica subplicatasame genus6.5%Altica aenescenssame genus6.5%Altica sylviasame genus6.8%Altica engstromisame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type276 records

Wild obs. + sensor230

Museum / vouchered46

Range

Area of Occupancy AOO844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 127≤1 km 26≤10 km 7>10 km 18

178 georeferenced · 52 without coordinates

Open the mapobservation + sensor230

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤1 km 13≤10 km 10>10 km 11

34 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence46

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alabamalocation not on record	14
Albuquerque, US	9
Denver, US	4
Chicago, US	3
Cornell University Insect Collectionlocation not on record	3
Champaign, US	3
US	2
Budapest, HU	1
New Haven, US	1
Awka, NG	1
San Francisco, US	1
Washington, US	1

12 institutions · 43 of 46 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)