Altica tombacina

Mannerheim, 1853 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Altica

At a glance

Occurrence records544

Data sources5

Biological traits0

DNA specimens271

eDNA detections270

Sources5 archives

Databases and archives Altica tombacina's data was compiled from.

GBIFGlobal Biodiversity Information Facility544 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI270 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics271 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF544 records

Environmental DNA2 datasets · 2 countries270 detections

DNA & barcodingBOLD271 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding271 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Altica tombacina has left across the world's sequence archives.

At a glance

DNA specimens271

BINs1

Marker genes2

eDNA detections270

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus255 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

34Amostly conserved

85Avariable

298Gmostly conserved

346Amostly conserved

373Cvariable

472Gvariable

511Avariable

619Avariable

AACTTTATACTTTTTATTTGGAATTTGAGCTGGAATAATTGGTACCTCCATAAGACTTTTAATTCGTACTGAATTAGGAAGGCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.58%

Haplotypes23

BIN1

Most divergent pair2.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Altica torquatasame genus4.6%Altica aenescenssame genus5.3%Altica lythrisame genus5.4%Altica longicollissame genus5.5%Altica chamaeneriisame genus5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S

animal barcoderibosomal

08Occurrence & distribution

Record type544 records

Wild obs. + sensor11

Museum / vouchered533

Range

Area of Occupancy AOO460 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 6>10 km 1

7 georeferenced · 4 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 84≤1 km 24≤10 km 2>10 km 2

112 georeferenced · 421 without coordinates

Open the institutions mapphysical evidence533

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	133
Edmonton, CA	107
Royal Saskatchewan Museumlocation not on record	61
University of Alberta Museums (UAM)location not on record	29
Centre for Biodiversity Genomicslocation not on record	6
DOI/FWS, Kenai National Wildlife Refugelocation not on record	5
Saint John, CA	3
Espace pour la vielocation not on record	2
Champaign, US	2
University of Manitoba, Wallis Roughley Museum of Entomologylocation not on record	1

10 institutions · 349 of 533 vouchered records shown · 184 without an institution code

09Environmental DNA270 detections

Where the DNA of Altica tombacina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found270

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 270 detections have coordinates

Open the map2 countries0

Clear Cutwood cutting area, w. spruce, birch, grass1. Forest & Woodland|1.1. Boreal Forest1. Forest & Woodland5. Wetlands (inland)Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.0 °C 6.60–16.1

Seasonal swing summer↔winter37.0 °C

Max temp (day)15.2 °C 9.40–21.5

Min temp (night)8.10 °C 4.10–10.4

Precipitation88.0 mm/mo 38.2–101

Air humidity61.4 % 53.4–62.9

Moisture balance-15.7 mm/mo -71.4–26.8

Vapour deficit503 Pa 369–791

Wind speed2.80 m/s 1.40–4.60

Cloud cover44.2 % 36.6–51.2

CHELSA 1981–2010, ~9 km grid, at location & month of 265 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)