Altica aenescens

(Weise, 1888) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Altica

At a glance

Occurrence records315

Data sources5

Biological traits0

DNA specimens12

eDNA detections0

Sources5 archives

Databases and archives Altica aenescens's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility315 records↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF315 records

DNA & barcodingBOLD12 specimens

01Narrative

Altica aenescens is a species of leaf beetle from the subfamily Galerucinae. It is distributed in Northern and Central Europe, as far south as northern Italy. Parts of Northern Europe include Belarus, Belgium, Finland, and Sweden.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Altica aenescens has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.1%

Haplotypes2

BIN1

Most divergent pair1.4%

Where individuals differ — all 18 variable positions, in barcode order

55Gvariable

70Tvariable

85Gvariable

88Gvariable

133Tvariable

163Avariable

217Gmostly conserved

223Gmostly conserved

346Cmostly conserved

412Avariable

421Amostly conserved

433Tmostly conserved

436Cvariable

458Avariable

475Amostly conserved

529Cvariable

562Cvariable

622Cmostly conserved

AACTTTATATTTTCTATTTGGAATTTGAGCTGGAATAATTGGTACCTCCATAAGGCTTTTAATTCGTACTGAATTAGGAAGACCGGGGTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Altica lythrisame genus1.5%Altica longicollissame genus1.8%Altica engstromisame genus2.1%Altica ampelophagasame genus2.4%Altica quercetorumsame genus2.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type315 records

Wild obs. + sensor224

Museum / vouchered91

Range

Area of Occupancy AOO760 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 13≤1 km 47≤10 km 22>10 km 1

83 georeferenced · 141 without coordinates

Open the mapobservation + sensor224

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 3≤1 km 30≤10 km 31

64 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence91

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum Rotterdamlocation not on record	24
Tilburg, NL	12
ZSMlocation not on record	11
Helsinki, FI	8
Salzburg, AT	5
Tallinn, EE	5
Champaign, US	3
MZLUlocation not on record	2
IFR-DNFlocation not on record	1
SLU Artdatabankenlocation not on record	1

10 institutions · 72 of 91 vouchered records shown · 19 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)