Altica quercetorum

Foudras, 1860 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Altica

At a glance

Occurrence records662

Data sources4

Biological traits0

DNA specimens9

eDNA detections1

Sources4 archives

Databases and archives Altica quercetorum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility662 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF662 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD9 specimens

01Narrative

De eikenaardvlo is een keversoort uit de familie bladkevers (Chrysomelidae), die tot de tribus Alticini behoort. De wetenschappelijke naam van de soort werd in 1860 gepubliceerd door Antoine Casimir Marguerite Eugène Foudras. De soort komt van nature voor in Europa, vooral in Zuid-Europa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Altica quercetorum has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.49%

Haplotypes1

BIN1

Where individuals differ — all 12 variable positions, in barcode order

23Amostly conserved

58Tmostly conserved

88Gmostly conserved

124Cmostly conserved

163Gmostly conserved

271Gmostly conserved

316Gmostly conserved

406Tmostly conserved

445Cmostly conserved

529Tvariable

583Cmostly conserved

633Amostly conserved

AACTTTATACTTTCTATTTGGAATTTGAGCTGGAATAATTGGTACCTCTATAAGACTTTTAATTCGTACTGAATTAGGAAGGCCTGGGTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Altica longicollissame genus2.1%Altica aenescenssame genus2.7%Altica ampelophagasame genus2.9%Altica chamaeneriisame genus3.2%Altica brevicollissame genus3.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type662 records

Wild obs. + sensor402

Museum / vouchered260

Range

Area of Occupancy AOO1 788 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 135≤1 km 58≤10 km 76>10 km 7

276 georeferenced · 126 without coordinates

Open the mapobservation + sensor402

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 114≤1 km 77≤10 km 44>10 km 2

237 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence260

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	92
Trondheim, NO	41
NHMOlocation not on record	20
Muzeum Górnośląskie w Bytomiulocation not on record	14
NTNU-VMlocation not on record	13
Olocation not on record	11
Museu Nacional de História Natural e da Ciêncialocation not on record	10
IFR-DNFlocation not on record	9
neflocation not on record	9
Tilburg, NL	8
Natural History Museum Rotterdamlocation not on record	6
Ugentlocation not on record	4
Tartu, EE	2
NMOKlocation not on record	2
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	1
ZSMlocation not on record	1
MZLUlocation not on record	1
Winterthur, CH	1

18 institutions · 245 of 260 vouchered records shown · 15 without an institution code

09Environmental DNA1 detections

Where the DNA of Altica quercetorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)