Altica brevicollis

Foudras, 1860 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Altica

At a glance

Occurrence records460

Data sources6

Biological traits2

DNA specimens21

eDNA detections0

Sources6 archives

Databases and archives Altica brevicollis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility460 records↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF460 records

DNA & barcodingBOLD21 specimens

Genome at a glanceGoaT · TreeOfSex2n = 24

01Narrative

Altica brevicollis is een keversoort uit de familie bladkevers (Chrysomelidae). De wetenschappelijke naam van de soort werd in 1860 gepubliceerd door Foudras.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Altica brevicollis has left across the world's sequence archives.

At a glance

DNA specimens21

BINs2

Marker genes1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 42 variable positions, in barcode order

7Tmostly conserved

31Amostly conserved

40Cvariable

46Cmostly conserved

52Gmostly conserved

56Tmostly conserved

67Cvariable

79Amostly conserved

82Gvariable

85Gmostly conserved

103Cmostly conserved

130Tmostly conserved

160Amostly conserved

196Tmostly conserved

197Gmostly conserved

220Gmostly conserved

226Amostly conserved

241Amostly conserved

268Gmostly conserved

295Amostly conserved

299Tmostly conserved

313Gmostly conserved

334Tvariable

340Tvariable

343Cmostly conserved

344Tvariable

349Tmostly conserved

403Tmostly conserved

409Tmostly conserved

418Amostly conserved

433Cmostly conserved

455Gmostly conserved

463Amostly conserved

478Amostly conserved

526Tvariable

559Tmostly conserved

589Tmostly conserved

616Amostly conserved

619Cvariable

625Amostly conserved

628Amostly conserved

631Cmostly conserved

TTTATATTTTCTATTTGGAATTTGAGCTGGAATAATTGGCACCTCCATAAGGCTTTTAATTCGTACCGAATTAGGAAGACCGGGGTCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes8

BINs2

Most divergent pair4.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Altica longicollissame genus1.5%Altica lythrisame genus1.9%Altica ampelophagasame genus2.9%Altica engstromisame genus3.1%Altica quercetorumsame genus3.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Altica brevicollis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidy2× diploid · measured

Chromosome records24–242n range24median24mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 245×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Petitpierre E, Segarra C, Yadav JS, Virkki N (1988) Chromosome number and meioformulae of Chrysomelidae. In: Jolivet P, Petitpierre E, Hsiao TH, editors. Biology of Chrysomelidae. Boston: Kluwer Academic Publishers. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type460 records

Wild obs. + sensor272

Museum / vouchered188

Range

Area of Occupancy AOO976 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 54≤1 km 72≤10 km 54>10 km 1

181 georeferenced · 91 without coordinates

Open the mapobservation + sensor272

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 16≤1 km 41≤10 km 113

170 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence188

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	75
SLU Artdatabankenlocation not on record	29
Natural History Museum Rotterdamlocation not on record	13
NTNU-VMlocation not on record	10
Museu Nacional de História Natural e da Ciêncialocation not on record	8
CBDClocation not on record	6
South Kensington, GB	6
Tallinn, EE	5
Trondheim, NO	4
Tilburg, NL	2
Philadelphia, US	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
BioFokuslocation not on record	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1

14 institutions · 162 of 188 vouchered records shown · 26 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)